Катерина успенская экстрасенс: Катерина Успенская — консультации по телефону

Автор: | 10.05.2021


Катерина Успенская — консультации по телефону

«Будьте добрее, помогайте ближним! Не держите обид на людей в душах — это убивает вас самих. Любовь — начало всех начал!»


В своей работе больше всего люблю видеть закономерный результат моих знаний и усилий. На деле эзотерика может помочь человеку во многом — открыв ему будущее, она подскажет, как лучше поступить или чего стоит избегать. И увидев это, он может повернуть время вспять.

Бабушка моя была верующий человек и помогала людям. Она меня многому научила и многое мне передала по поколению женского рода, чему я очень благодарна. Дар у меня проявился в 5 лет в ярких моментах: я видела смерти людей и их беды и говорила это маме всегда. Также сны — все они всегда вещие были. Все это через какое‍-‍то время свершалось и меня это пугало. Позже мне все бабушка объяснила и эти видения больше не пугали так меня.

Я всегда ответственна в работе и делах. Я не могу бросать людей в беде зная, что должна помочь. Также сложно видеть многое и про многих. Многие побаиваются меня, но я светлый человек и горжусь этим. По эзотерике мне близки светлые силы и славянские боги. Я работаю с картами Таро Ленорман и рунами, использую другие колоды для диагностики и просмотров. Работаю по энергопотокам человека и по фото. Нумерология и астрология тоже близки, сны расшифровываю по просьбе клиентов.

Совет людям могу дать такой — будьте добрее, помогайте ближним! Не держите обид на людей в душах — это убивает вас самих. Любовь — важнейшее начало всех начал. Не бойтесь любить и дарить любовь. Живите в вере в себя и в других. Стремитесь к лучшему!

Показать полностью Скрыть

Консультирую на темы: Любовь, Семья, Финансы, Работа, Энергетика, Бизнес.

Звезда 21-го сезона «Битвы экстрасенсов» Марьяна Романова назвала Марата Башарова «комфортным ведущим»

19:42, 13.11.2020


Практикующая ведьма надеется, что они с актером будут общаться и вне проекта.

Поделиться | Понравилось

Марьяна Романова вошла в состав участников 21-го сезона «Битвы экстрасенсов» и моментально снискала любовь телезрителя. Практикующая ведьма умело находит общий язык как с героями испытаний, так и с командой мистического проекта. Ясновидящая не любит конфликтов и никого не провоцирует. Вот и про ведущего Марата Башарова, который легко может схлестнуться с участниками, Марьяна в интервью «Вокруг ТВ» не сказала ничего плохого.

«Марат Башаров — комфортный ведущий. И он, и Вера Сотникова прекрасно понимают, что такое потоковое состояние, где можно бросить в лицо экстрасенсу неудобный вопрос, а где — лучше промолчать. Наверное, этому помогает профессия — актерское мастерство требует от человека высокой чувственности. Общаться вне съемок ни у кого нет времени, потому что «Битва…» занимает в жизни центральную часть. Возможно, после окончания проекта будем общаться, почему бы и нет», — поделилась Романова.

Марьяна Романова

Ведущим «Битвы экстрасенсов» Марат Башаров стал в 2009 году, сменив на этом посту Михаила Пореченкова.

За 11 лет работы Башаров неоднократно оказывался в центре скандала из-за своего поведения. Так, в 2012 году суд лишил его прав за управление автомобилем в состоянии алкогольного опьянения. А спустя два года вторая супруга актера Екатерина Архарова заявила, что он избил ее и сломал нос. В обоих случаях продюсеры «Битвы» отстояли честь ведущего и не уволили его.

Очередной скандал вокруг имени Марата Башарова возник в канун 2019 года. 27 декабря стало известно, что 46-летний актер поднял руку на молодую супругу Елизавету Шевыркову. Информацию предал огласке брат пострадавшей, отметив, что это не первый раз, когда Башаров бьет жену. В итоге, Елизавета попала в больницу, где ей диагностировали перелом носа.

На протяжении полутора месяцев Шевыркова хранила молчание. Башаров же в программе «Ты не поверишь!» опроверг появившиеся слухи и заявил, что они с женой смеются над подобными новостями. Однако в середине февраля 2019-го Елизавета решилась на публичную исповедь: она подтвердила, что муж поднимал на нее руку, а также сообщила о разрыве с актером. Официально брак был расторгнут 21 марта прошлого года. Общий сын пары

Марсель остался с матерью. При разводе Башаров отписал экс-супруге и наследнику одну из своих квартир.

Марат Башаров и Елизавета Шевыркова

В сентябре текущего года Марат Башаров внезапно заявил, что живет в одной квартире с Елизаветой Шевырковой. По словам актера, несмотря на скандальный развод, сейчас в паре царит полная идиллия. Башаров даже подчеркнул, что они с Шевырковой спят в одной кровати. Стоит отметить, что после выхода интервью актера о его жизни с Елизаветой, сама Шевыркова опровергла информацию о том, что экс-супруги живут вместе. В своем микроблоге в Instagram она опубликовала скриншот статей СМИ, которые написали о воссоединении пары, а сверху подписала, что это фейк. Но Башаров продолжает настаивать на своем: в октябрьском интервью артист заявил, что они с Елизаветой Шевырковой вовсе не расставались.

Марат Башаров с сыном

Читайте также:

Звезда 21-го сезона «Битвы экстрасенсов» Марьяна Романова объяснила, почему не против приворота

Участница 21-го сезона «Битвы экстрасенсов» Марьяна Романова: «Мертвая девочка из испытания несколько раз приходила ко мне во сне»

Участник 21-го сезона «Битвы экстрасенсов» Олег Шепс: «Все, что касается моей личной жизни, навсегда останется тайной»

Экстрасенс о Варнаве и Мякинькове: «Нет былой страсти» — Звезды

Марианна Абравитова рассказала о нынешних отношениях пары

Марианна Абравитова

11 декабря 2019 17:12

Екатерина Варнава и Константин Мякиньков

Фото: Instagram.com

Екатерина Варнава на днях отметила 35-летие. В ходе интервью, приуроченных к юбилею девушки, журналисты интересовались, когда же теледива выйдет замуж за своего давнего возлюбленного, хореографа Константина Мякинькова, ведь он сделал предложение еще два года назад. В ответ Варнава отшутилась — мол, жених так и не накопил на кольцо. А затем заявила, что никакой свадьбы не будет, потому что роль «старой невесты» ее не устраивает. При этом девушка не стала вдаваться в подробности своих нынешних отношений с Константином. Однако в шуточном фотоколлаже, опубликованном в честь дня рождения, Катя один из снимков подписала так: «Что ни пассажир, то транзитный…» Теперь поклонники беспокоятся, уж не рассталась ли теледива с Мякиньковым. Что же происходит в отношениях пары и поженится ли она в итоге, WomanHit.ru спросил у таролога и экстрасенса Марианны Абравитовой.

«Сейчас не так уж и модно выходить замуж, и многие выбирают свободные отношения. У кого-то это гражданский брак, у кого-то — гостевой, но все равно это любовные отношения. В случае с Варнавой все шло к свадьбе, но так как все сейчас тормозится, отношения у них забуксовали. Момент семейной и безоблачной счастливой жизни упущен», — считает Марианна.

«Отношения не дойдут до свадьбы, потому что уже в отношении друг друга много претензий и обид. В их союзе все очень вязко. Карты говорят о том, что брак очень иллюзорен. Более того, совета укреплять эти отношения уже нет. Все самое острое, яркое и интересное в их отношениях уже позади. Я бы посоветовала им не ставить тему с узакониванием отношений во главу угла, а все же успокоиться и отпустить. Скажу больше, даже в постели они уже не так тяготеют друг к другу, и сексуальный компонент не на первом месте. Все их конфликты на бытовом уровне, и нет былой страсти. Варнава вообще человек со сложным характером, эгоцентричная, слишком сосредоточена на творчестве, и жить с такой дамой очень сложно. В классическом смысле слова, жена — это совсем не про Екатерину», — рассказала Абравитова.

Вампир, рэпер и актриса: кто пришел на кастинг новой «Битвы экстрасенсов»

Кастинг новой «Битвы экстрасенсов»

Фото: Instagram

Сегодня, 22 сентября, стартует 19-й сезон самого мистического шоу «Битва экстрасенсов». Маги, гадалки и ясновидящие со всей России и из-за рубежа собрались этим летом на кастинге в Москве, чтобы испытать себя на прочность. Новичков поддерживали другие экстрасенсы, ранее участвовавшие в проекте. Звезда предыдущего сезона, ведьма Соня Егорова наблюдала за происходящим на всеобщем кастинге. 

«Никого не поддерживала, просто пришла посмотреть на людей, пришедших на кастинг. От нескольких участников была интересная энергетика, но их имен я не знаю», — поделилась Егорова со «СтарХитом». 

Мы провели собственное расследование и нашли людей, которые принимали участие в кастинге на «Битву экстрасенсов», а многие даже попали на проект. 


Георгий Малиновский

Фото: Instagram

В 16-м сезоне «Битвы экстрасенсов» Георгий Малиновский уже принимал участие, но тогда смог дойти лишь до пятой серии. Несмотря на тяжелые проблемы со зрением и микроинсульт, Георгий продолжает практиковать магию, хотя уже почти не ведет приемы для людей.

Как стало известно «СтарХиту» маг не только появился на кастинге 19-го сезона, но и успешно прошел отбор.

«В этот сезон передачи пробовал пройти Никита Платонов, сюда очень хотели попасть финалисты 18 сезона «Битвы экстрасенсов», но прошел только я. В новом сезоне примут участие святой экстрасенс, люди, которые будут работать посредством звука, будут те, кто работают через мертвых, но не вызывая их, а мертвые будут ходить за экстрасенсами. Наконец-то в сезоне появятся два вампира», — поделился Георгий.


Варвара Панина

Фото: Кадр из программы

Ведьма из Минска Варвара Панина успела познакомиться со многими участниками предыдущих сезонов. На снимках Панина позировала с Намтаром Энзигалем, а на  кастинге общалась с Соней Егоровой. 

Варвара начала замечать свой дар в детстве. Когда ей было 8 лет, у нее умерли бабушка и сестра с разницей в несколько месяцев. Семья переехала жить в квартиру пожилой родственницы. «Я пережила абсолютно страшные для себя полгода — почти ничего не помню, память заблокировала, но свидетельства очевидцев довольно пугающие. Мне часто снился сон, в котором в стене открывался проем, а бабушка шла ко мне и звала за собой. В самый последний момент прибегал папа, захлопывал дверь и держал ее спиной. Мне постоянно чудилось,что я открою глаза, и перед лицом будет портрет бабушки. Я слышала шепот и видела вполне четкую женскую фигуру. Мама воспринимала мои рассказы как детские бредни, я помню, очень четкое понимание того, что с «этим» я один на один и никто мне не  верит. Потом я очень сильно заболела, лежала в больнице. Врачи не разрешали забирать меня домой — говорили,что помру», — вспоминала о том периоде Варвара.

24-летняя девушка пишет стихотворения, а некоторое время назад работала в театре. Теперь она трудится в сфере журналистики.


Елена Майер

Фото: ВКонтакте

Еще одной яркой героиней кастинга стала 34-летняя экстрасенс-самоучка Елена Майер. «Место красивое, но впечатление портила близость морга, помимо энергии, там еще и запах стоял, это видимо формальдегид или еще что. Еще плохой знак, что на испытании одна женщина упала в приступе», – признавалась Елена, вспоминая день кастинга.

Впервые экстрасенсорные способности ведьма обнаружила у себя в 17 лет, хотя заниматься их развитием начала двумя годами ранее, практикуя йогу. Как признавалась сама Майер, на кастинг она пришла, чтобы не только испытать себя, но и продвинуть собственную книгу. «На отборе не переживала, потому что, если провалишь его или первое испытание, то репутацию не сильно подмочишь – в эфире ведь не покажут. Это была как игра и развлечение, мне понравилось! Много интересных людей, среди них есть настоящие экстрасенсы», – заявила Елена.


Александр Левичев

Фото: Вконтакте

Бывший помощник главы городского округа Чехов Александр Левичев, в рэпе известный как СПЗ, также решил попробовать свои силы в «Битве экстрасенсов». Александр рассказал, что в детстве ровесники часто относились к нему с пренебрежением, и лишь повзрослев он смог продемонстрировать всем свои лидерские качества. Левичев получил юридическое образование, но работать пошел бригадиром массовки в кино, что, возможно, и предопределило его судьбу. В его биографии немало ярких страниц – работа на заводе, собственный бизнес и даже работал с хоккейной командой «Витязь». Неудивительно, что на кастинге Александр заинтересовал не только строгое жюри, но и конкурентов.

О кастинге на «Битву экстрасенсов» мужчина узнал из рекламы на канале ТНТ.

«Мне позвонили и пригласили на кастинг. Я хотел сделать так, чтобы обо мне поговорили. Отбор проходил в обычном здании. Когда подошла моя очередь, рассказал всем присутствующим о своей жизни. Мне дали конверт, но я провалил задание. Во втором этапе нужно было рассказать об одной из присутствующих девушек. И вот, когда я вышел оттуда, решил — хочу быть здесь», — поделился Александр.

К Левичеву потом обратилась девушка Анна Соколова, которая работала тарологом. Она многое рассказала о нем, что сбылось, а также научила его некоторым моментам. Левичев ждал звонка от съемочной группы. «У меня начинает зудеть рука, и мне звонит женщина с «Битвы экстрасенсов». Я приехал в парк, где проходит кастинг, за два часа. На поляне не было птиц, ни одной. Я увидел колоритную ведьму, армянку. Я прям чувствовал, что она подойдет и будет смотреть в глаза. Так и произошло. Потом она улыбается, я тоже, мы здороваемся», — рассказал Левичев.

По словам Александра, он продолжит развивать свои способности, так как теперь верит, что ничего невозможного для человека нет. 


Екатерина Хорошенко

Фото: Instagram

Участница проекта «Пацанки» Екатерина Хорошенко была замечена на кастинге «Битвы экстрасенсов». Девушка любит эпатировать публику. Многие гадают, что именно она делала на кастинге. Однако Катя не раскрывает подробности. 

«Кастинг, кстати, действительно честный, дают сначала просмотреть конверт черный, потом сканируешь человека. Никто ничего не подсказывает и не говорит, не помогает», — рассказала Хорошенко нашему корреспонденту.

Катя называет себя шаманкой. В одной из записей в социальной сети Хорошенко учила других людей находить тотем. «Как определить свой тотем? Многие писали, что по дате рождения, цифрам, нумерологии. Нет. Вы индивидуальность, если зайдёте на несколько форумов определения вашего тотема, вам везде дадут разный ответ. Вам нужно заглянуть вглубь себя. Самый простой способ — медитация. Учитесь пользоваться вашей энергией, и вы начнете ею управлять», — рассуждает девушка.


Манана Маршунова

Фото: Вконтакте

Манана Маршунова, участница 19-го сезона «Битвы экстрасенсов» из Санкт-Петербурга родилась в Грузии. Несколько лет назад она работала в центре Натальи Бантеевой. Она проводила ритуалы, заказанные клиентами. 60-летняя ведьма, по слухам, станет одной из участниц проекта. 


Витослава и Велеслав Черкасовы

Фото: Вконтакте

Супруги Витослава и Велеслав Черкасовы создали общество «Сатья-Веда». Его главная идея — существование неких славянских Вед, аналогичных индийским или даже предшествовавших им. Ритуалы, которые они практикуют, заимствуют что-то из индуизма, в частности, используют фаллическую символику и техники тантры. Они принимали участие в кастинге и проходили испытание «Багажник», но пока точно неизвестно, увидят ли их зрители в составе «Битвы экстрасенсов». 


Ритм сердца от ТНТ Анонсы на Rutube.

Экстрасенс Алена Полынь заявила, что Катя Лель не могла исцелить свою костюмершу

Певица Катя Лель сделала очередное удивительное заявление. По ее словам, буквально на днях она силой энергии рук исцелила свою костюмершу. Сообщается, что женщина упала с велосипеда и серьезно повредила плечевой сустав, врачи даже собирались проводить операцию, в процессе которой должны были вкрутить три винта и «поставить» в сустав искусственную капсулу. Но такая тяжелая процедура не понадобилась благодаря волшебным рукам исполнительницы.

— Я с помощью энергии провела раз пять около ее травмированного плеча. Рада, что смогла помочь близкому человеку, — сказала Лель, которая чуть ранее собирала пресс-конференцию и рассказывала, что свои суперсилы получила после контакта с инопланетянами.

PR-менеджер исполнительницы заявила корреспонденту «Вечерней Москвы», что певица действительно смогла помочь пострадавшей костюмерше. Инцидент произошел 13 августа. 

В таком сложном деле никогда не разберешься, где правда, а где ложь, без помощи эксперта. Поэтому «ВМ» связалась с известным экстрасенсом Аленой Полынь, которая высказалась относительно неоднозначных заявлений Лель.

На фото: певица Катя Лель  / Фото: Официальная страница Кати Лель в Instagram (https://www.instagram.com/katyalelofficial/?hl=ru)

— Определенными способностями обладает любой человек, — считает Алена. — Другой вопрос — развиваем мы их в себе или нет. Руками исцелять действительно можно, только вот если человек не подготовлен, это чревато последствиями как для него, так и для того, в отношении кого были произведены подобные действия. В случае с Лель могу сказать, что энергия у нее неплотная: достаточно много сил она тратит не на те действия, которые связаны с исцелением. Конечно, исцеление могло произойти случайно: когда мы очень хорошо относимся к человеку, безусловно, своими словами, желанием мы можем ему помочь. А напомните, от чего Лель вылечила свою костюмершу?

Алена Полынь уточнила у корреспондента «ВМ», от чего исцелила певица свою костюмершу. Услышав ответ, она сказала следующее:

— Нет, в это не верю стопроцентно, сделать этого она не могла. Даже суперспециалист, который работает в такой технике очень давно, может сделать это только за несколько сеансов. То, что рассказала, так сказать, прорезюмировала Лель, — чудо, приравниваемое к божественному вмешательству. Как если бы мы увидели, что кто-то идет по воде или летит. Конечно, это ложь. Тело человека имеет определенную структуру, и чтобы оно восстановилось, должно пройти некоторое время, даже если мы на него воздействовали.

Читайте также: Экстрасенс предрекла браку Собчак и Богомолова скорый конец

Поделиться в FBПоделиться в VKПоделиться в TWПоделиться в OK

История в лицах

Марина Михайловна – человек с интересной и очень нелегкой судьбой. Ее история и завораживает, и восхищает, и вызывает искреннее сочувствие…И лучше, чем она сама, эту историю не расскажет никто:

«Родилась 16 мая 1957 г. на Украине в Луганске (бывшем Ворошиловграде). В 3 месяца меня привезли в Москву, где с тех пор живу постоянно. В школе увлекалась литературой, русским и английским языками. С детства мечтала стать переводчиком. Была победительницей районной олимпиады по литературе. Начиная с 5 класса (с 11 лет) стала сочинять афоризмы, каламбуры и т.п. и даже посылала их в «Литературную газету». Но напечатали меня там только сейчас, когда мне исполнилось 60 лет!

После окончания школы пошла работать в Государственную библиотеку СССР им. В.И. Ленина (отдел диссертаций) (сейчас – РГБ) и одновременно училась на вечернем отделении Государственного института культуры, на факультете библиотековедения и библиографии. С 1970 г. увлеклась испанским певцом Рафаэлем (посмотрев фильм «Пусть говорят») и стала сама изучать испанский язык. Потом окончила заочные курсы испанского языка, курсы машинописи, и после окончания института в свободное от работы время стала подрабатывать переводчиком, редактором и корректором испанского языка. Моя мечта сбылась!

Затем я перешла в другую библиотеку – Государственную публичную научно-техническую библиотеку, где я работала редактором.

Также я стала членом общества дружбы «СССР – Испания», членом секции гитаристов при московском хоровом обществе, и имела счастье поработать переводчиком у знаменитого испанского гитариста Пако де Лусия. Также я посещала латиноамериканские семинары в Доме дружбы с народами зарубежных стран, где совершенствовала знание языка с носителями. Там мне приходилось встречаться с такими знаменитыми людьми, как посол Испании Хуан Антонио Самарранч (который стал потом председателем Международного Олимпийского комитета), космонавтами Терешковой и Джанибековым, поэтом Сергеем Михалковым, актрисой Людмилой Касаткиной и др. Также я увлеклась искусством испанского танца фламенко и ходила на концерты, когда исполнители фламенко приезжали на гастроли.

В 1983 г. я поехала в командировку в Волгоград переводчиком группы кубинских специалистов, где и познакомилась с будущим мужем-кубинцем. Мы поженились, и он уехал на Кубу. В 1984 г. я ездила на Кубу по его приглашению, но мы расстались, и я вернулась в Москву. Я очень тяжело переживала развод, т.к. почувствовала себя ненужной, лишней. Это была первая личная трагедия в моей жизни. Мне с детства не хватало любви, т.к. мать меня не любила, а только отец. Он водил меня на фигурное катание, на лыжи, в бассейн, благодаря ему я окончила детскую музыкальную школу по классу фортепиано. Когда отец умер, я ещё острее почувствовала своё одиночество и ненужность.

В 1988 году я познакомилась со своим вторым будущим мужем — студентом из Эквадора, и в 1990 г. родился наш сын, а в 1992 г. мы поженились. Но счастье было недолгим: муж бил меня и ребёнка. Я обратилась за защитой в полицию, но они меня не защитили. Муж грозил отнять у меня ребёнка и увезти его за границу. Но я спасла сына! Мы с мужем расстались… Он уехал на родину, а я осталась одна с ребёнком. Мы с сыном жили очень стеснённо в плане денег, и я не могла дать ему многого, хотя и старалась дать ему как можно больше, воспитать его хорошим, умным и разносторонним человеком. Но, к сожалению, сын унаследовал от отца агрессию, и отношения у нас с ним не сложились. Мне было очень трудно одной, помощи ждать было неоткуда. Тем не менее, сын окончил престижную школу, а потом – МГТУ им. Баумана, нашёл хорошую работу. В 2013 г. сын ушёл из дома, и я осталась одна.

Я старалась отвлечься и применить свои природные данные к тому, что мне было интересно, а именно: к интеллектуальным играм, в частности, участвовала в телевизионных программах – таких, как «Кто хочет стать миллионером», «Слабое звено», «Алчность», «Обратный отсчёт», «Антимония», «Время – деньги», «Обмен бытовой техники», «Один против всех».

Я освоила компьютер, стала переводить письменные тексты, а также продолжала работать устным переводчиком (с туристами, на переговорах, на международных фестивалях, конгрессах и т.п.).

Когда я освоила компьютер, то в свободное от переводов время я увлеклась социальными сетями, и у меня появилось много друзей. В это же время я снова начала писать стихи и опубликовывать их в интернете, а также я возобновила создание афоризмов и других миниатюр в прозе. На это меня вдохновил один мой друг-актер. И хотя я рассталась соним, но всё же продолжила своё творчество, которое и стало моей отдушиной в жизни.

Однако мне было этого недостаточно, и я увлеклась интеллектуальными играми – «Своя игра», «Что?Где?Когда?» и др., вступила в клуб знатоков «Неспроста» и стала постоянно посещать игры-тренинги, а впоследствии стала и капитаном созданной мной команды по «Что?Где?Когда?» «Мозги на месте».

Благодаря увлечению поэзией я начала посещать различные музыкально-поэтические салоны и клубы Москвы, где и стала выступать со своими стихами, песнями, афоризмами и переводами. Также я вступила в клуб сатириков и юмористов «Чёртова дюжина», в различные ЛИТО (литературныеобъединения), стала участвовать в различных фестивалях музыки и поэзии в Москве и Подмосковье. Я познакомилась со многими интересными людьми, в т.ч. такими знаменитыми, как бард и учёный Александр Городницкий, поэт Андрей Дементьев, композитор Григорий Гладков, писатель Эдуард Успенский и др. Я имела счастье творческого сотрудничества с некоторыми из них. Я приобрела некоторую известность в музыкально-поэтических кругах Москвы благодаря публикации в интернете своих произведений, фото и видеороликов своих выступлений. Дважды я участвовала в программе Радио России «В нашу гавань заходили корабли». Мои произведения были опубликованы в сборниках, альманахе и в прессе.

В 2013 г. я познакомилась с одним талантливым бардом, певцом, поэтом, гитаристом и композитором, с которым мы стали вместе писать стихи и песни и выступать дуэтом. У нас с ним был роман, и я ощутила прилив сил и вдохновения. Я почувствовала свою нужность и востребованность, тем более, что мой сын ушёл из дома и стал жить отдельно. Но в 2014 г. мой мужчина меня предал, и я осталась одна!Это стало величайшей трагедией в моей жизни! Ведь мне было уже 57 лет. Он был моей последней любовью. Мне казалось, что у меня выбита почва из-под ног, и я лечу в пропасть! Я была в ужасно стрессовом и подавленном состоянии, не знала, как выбраться из жизненного тупика. И в этот момент меня познакомили с одним колдуном-экстрасенсом, который уверял, что сможет мне помочь. И несмотря на то, что я никогда не верила ни во что сверхъестественное, я невольно уцепилась за него, как утопающий за соломинку. Но он воспользовался и злоупотребил моим горем и моим стрессовым состоянием. Он объяснил мне, что моего мужчину увела другая женщина-колдунья, и она сделала так, что вскоре умрём мы с сыном, чтобы отвлечь меня от этого мужчины, чтобы я не пыталась вернуть его себе. Я была в панике, вне себя от страха, что потеряю сына, и во что бы то ни стало, хотела его спасти. Этот колдун объяснил мне, что для этого он должен провести обряд с такой суммой наличных денег, которая бы равнялась половине стоимости моей квартиры. Он сказал, что эти деньги останутся у меня, а ему от меня ничего не надо, т.к.якобы настоящая, действенная помощь оказывается бесплатно. Он сказал, что для проведения обряда ему нужно 3 дня. Мне неоткуда было взять деньги, но я думала только о спасении сына, о своём материнском долге. И я рискнула взять деньги в банке под залог квартиры. Колдун уверял меня, что через 3 дня я смогу вернуть деньги банку. Я в этот момент думала только об одном – как не допустить смерти сына. Я бы этого не пережила, а всё остальное в жизни – не важно.

Но колдун тоже оказался мошенником и отнял у меня все деньги, оставив меня ни с чем.Я обращалась в полицию, в прокуратуру, в Следственный комитет, потратила много денег на адвокатов, но никто мне не смог помочь. Я вынуждена была продать квартиру, чтобы вернуть деньги банку, иначе банк грозился отнять у меня квартиру за неуплату. Я осталась на улице. Пришла в ЦСО, и они отправили меня в Центр социальной адаптации «Люблино». Это было в 2015 г.

Риэлтор, которая помогла мне продать квартиру, помогла также купить долю в другой квартире. Однако туда меня не пускают соседи, угрожают собакой и грозят убить, если я попытаюсь туда вселиться.

Вот и осталась у меня единственная надежда на то, что я смогу спокойно дожить свои дни здесь, в ЦСА, которое стало мне настоящим домой, где тихо и светло, и где всегда готовы тебя выслушать и понять.

А ещё у меня есть мечта: выпустить, наконец, свой сборник стихов, в которомбыло бы отражено всё моё творчество – стихи, песни, афоризмы и переводы. И я надеюсь, что моя мечта сбудется…».

Тверские соседи Мары Багдасарян думают, что она — экстрасенс

Кажется, адрес тверской прописки знаменитой на всю Россию нарушительницы правил дорожного движения Мары Багдасарян, уже не секрет. По крайней мере, для нас. Мы отправились на улицу Мусоргского, чтобы просто посмотреть, где же прописалась представительница «золотой молодёжи». Мара, по официальной версии, уже в Твери, т.к. сюда, в Тверскую область, из Москвы было передано всё её исполнительное производство — главный бэкграунд , из-за которого она и прославилась на всю страну: сотни неоплаченных штрафов, принудительные работы и прогулы, поддельные больничные листы и пожизненное лишение прав из-за болезни.

В Твери Мара должна работать. Долго и упорно. Мы уже писали о том, что вероятнее всего она по медицинским показаниям попадёт в библиотеку им. А.И. Герцена, однако этот вопрос пока не решён, и обсуждается.

То есть логичнее всего, что Мары в Твери нет. Однако, голос из-за двери нас уверил, что всё не так.

Однако, обо всём по порядку.

Дом по улице Мусоргского, где официально зарегистрирована Багдасарян — это двухэтажное здание постройки конца 1950-х годов. Будь дом отремонтирован, а территория ухожена, он мог бы быть прекрасным местом для жизни — такой маленький тихий дворик с цветочками, собачками и бельём на верёвке.

В подъезде Мары полумрак и все прелести открытых подъездов: адресные оскорбления на стенах, похабщина, разноцветные почтовые ящики и пыльная грязная лампочка.

Мы звоним в дверь. Шаги бодро приближаются и превращаются резко в вопрос:»кто там»? Голос женский.

На это можно ответить только как в старом-добром детстве: «А Мара дома»?

Хотя мы, конечно, спросили по-взрослому Мару Эльмаровну.

— Нет её, она на работе.

— А когда она будет?

— Ой, я не знаю, ребята, звоните ей, молодые люди. Что мы должны её за ручку водить?

— Во сколько она бывает дома?

— Ребята, дома не устраивайте…

— Скажите, а она вообще в Твери?

— В Твери. Она работает и приезжает сюда.

— А вы родственники получается?

Внутренняя дверь захлопнулась.

Нужно быть очень наивным человеком, чтобы поверить, что Мара здесь живёт и сюда приезжает после работы. Всё это очень похоже на слова, которые нужно произносить из-за двери для назойливых журналистов и, вероятно, приставов.

Подходим к девушке Марине, которая вышла из соседнего подъезда и села за руль автомобиля.

— Скажите, вы знаете, кто такая Мара Багдасарян?

Девушка улыбается и пожимает плечами.

— Вы телевизор смотрите?

— Экстрасенс?

Мы объясняем, кто это, и Марина вспоминает, что действительно, краем уха слышала эту историю в новостях.

— Так вот она у вас теперь прописана в доме. Вот в этом подъезде.

— А я не знаю, я из другого подъезда. А это бомжацкий подъезд, там алкоголики живут.

Марина снимает квартиру в «подъезде трезвенников» и ни слухом, ни духом, кто живёт в соседнем подъезде. Про свой дом она знает только, что капитальный ремонт здесь будут делать в следующем году.

— Тут чужих никогда не бывает, так тихо, все свои.

Идём снова в подъезд в надежде застать кого-то из соседей. Молодой человек Алексей живет в квартире рядом. Он объясняет, что в квартире рядом живёт женщина «за пятьдесят».

— И ещё какой-то мужской голос.

Алексей вообще ничего не знает ни про какую Мару, он телевизор не смотрит, он — счастливый человек.

Женщина со второго этажа сквозь петунии тоже уверяет, что у них всё тихо, они никого чужих не видели и не слышали. Мары здесь нет, нет даже малой вероятности, что она хоть раз в жизни здесь была. Есть только женский голос из-за двери, который уверяет об обратном. И уверяет очень убедительно незнакомым людям, что Мара Эльмаровна, как обычный человек в этой стране, просто ушла на работу.

Мара Багдасарян — скандальная гонщица по московским улицам, дочь владельца крупнейшей фирмы по переработке мяса. Неоднократная участница ДТП, самым страшным из которых стала авария на Кутузовском проспекте в Москве в 2015 году, в котором погибло 3 человека.

По совокупности правонарушений приговорена судом к принудительным работам, но на работу не являлась, предоставив поддельный больничный лист. Пожизненно лишена водительских прав из-за эпилепсии. Официально должна проходить принудительные работы в Твери.

Центр решений в области чистой энергии | Поиск ресурсов по политике чистой энергии по ключевому слову

В этом отчете представлен анализ преимуществ, затрат, эффективности и проблем, связанных с внедрением программы реагирования на спрос среди клиентов коммерческого класса, расположенных в пяти округах области залива Сан-Франциско.

Источник: Энергетическая комиссия Калифорнии

Дата: ноябрь 2010 г.

В этом отчете представлены результаты исследований, касающихся прошлых и текущих уровней потребления электроэнергии домохозяйствами.Основные результаты прошлых исследований потребления электроэнергии в домашних хозяйствах представлены и сравниваются с нынешними уровнями потребления, чтобы отметить прогресс в области энергоэффективности.

Источник: Исследовательский институт электроэнергетики США

Дата: февраль 2009 г.

В этом отчете рассматривается влияние передачи и эксплуатации в результате значительного увеличения количества возобновляемых ресурсов в энергосистеме.

Источник: Независимый оператор услуг США, Калифорния,

Дата: ноябрь 2007 г.

В этом отчете исследуются механизмы, внедренные политиками для ограничения затрат на политику льготных тарифов.Если такие механизмы разработаны четко и прозрачно, они могут согласовать ожидания политиков и рынка в отношении развертывания проектов. Оцениваются три различных инструмента политики: (1) ограничения.

Источник: Национальная лаборатория возобновляемых источников энергии США, E3 Analytics


Дата: июль 2011 г.

Этот отчет служит руководством для разработчиков политики в развитии транспортных услуг для своих стран. По словам авторов, представленные рекомендации по политике не относятся к конкретному географическому региону и могут быть реализованы где угодно.

Источник: Программа ООН по окружающей среде

Дата: август 2011 г.

В этом отчете рассматриваются различные механизмы политики, которые могут укрепить государственно-частное партнерство (ГЧП).

Источник: United Nations


Дата: август 2011 г.

В этом отчете анализируется политика электрификации сельских районов Бразилии, Китая, Южной Африки и Индии, чтобы помочь политикам в разработке эффективного плана электрификации сельских районов.В документе излагаются различные пути, которые пошли каждой страной для достижения своих целей по электрификации сельских районов.

Источник: Международное энергетическое агентство

Дата: март 2010 г.

В этом документе представлены варианты политики в рамках структуры Промышленных стандартов, разработанные для содействия изменению организационной культуры, необходимому для реализации и сохранения энергоэффективности в промышленности с течением времени.

Источник: США, Национальная лаборатория Лоуренса Беркли, США.

Дата: август 2011 г.

Этот документ предназначен для создания структуры и методологии для отбора участков, выбора участков и первоначальной характеристики участков геологического связывания углекислого газа, которые предоставляют заинтересованным сторонам сборник передовых методов; поделиться опытом, полученным в США

Источник: Национальная лаборатория энергетических технологий США

Дата: ноябрь 2010 г.

Этот атлас обновляет потенциал секвестрации углекислого газа (CO2) в Соединенных Штатах и ​​Канаде, а также предоставляет обновленную информацию о полевых мероприятиях региональных партнерств по секвестрации углерода (RCSP).Кроме того, в атласе указаны США


Источник: Национальная лаборатория энергетических технологий США

Центр решений в области чистой энергии | Поиск ресурсов по политике чистой энергии по ключевому слову

В этом отчете представлен анализ преимуществ, затрат, эффективности и проблем, связанных с внедрением программы реагирования на спрос среди клиентов коммерческого класса, расположенных в пяти округах области залива Сан-Франциско.

Источник: Энергетическая комиссия Калифорнии

Дата: ноябрь 2010 г.

В этом отчете представлены результаты исследований, касающихся прошлых и текущих уровней потребления электроэнергии домохозяйствами.Основные результаты прошлых исследований потребления электроэнергии в домашних хозяйствах представлены и сравниваются с нынешними уровнями потребления, чтобы отметить прогресс в области энергоэффективности.

Источник: Исследовательский институт электроэнергетики США

Дата: февраль 2009 г.

В этом отчете рассматривается влияние передачи и эксплуатации в результате значительного увеличения количества возобновляемых ресурсов в энергосистеме.

Источник: Независимый оператор услуг США, Калифорния,

Дата: ноябрь 2007 г.

В этом отчете исследуются механизмы, внедренные политиками для ограничения затрат на политику льготных тарифов.Если такие механизмы разработаны четко и прозрачно, они могут согласовать ожидания политиков и рынка в отношении развертывания проектов. Оцениваются три различных инструмента политики: (1) ограничения.

Источник: Национальная лаборатория возобновляемых источников энергии США, E3 Analytics


Дата: июль 2011 г.

Этот отчет служит руководством для разработчиков политики в развитии транспортных услуг для своих стран. По словам авторов, представленные рекомендации по политике не относятся к конкретному географическому региону и могут быть реализованы где угодно.

Источник: Программа ООН по окружающей среде

Дата: август 2011 г.

В этом отчете рассматриваются различные механизмы политики, которые могут укрепить государственно-частное партнерство (ГЧП).

Источник: United Nations


Дата: август 2011 г.

В этом отчете анализируется политика электрификации сельских районов Бразилии, Китая, Южной Африки и Индии, чтобы помочь политикам в разработке эффективного плана электрификации сельских районов.В документе излагаются различные пути, которые пошли каждой страной для достижения своих целей по электрификации сельских районов.

Источник: Международное энергетическое агентство

Дата: март 2010 г.

В этом документе представлены варианты политики в рамках структуры Промышленных стандартов, разработанные для содействия изменению организационной культуры, необходимому для реализации и сохранения энергоэффективности в промышленности с течением времени.

Источник: США, Национальная лаборатория Лоуренса Беркли, США.

Дата: август 2011 г.

Этот документ предназначен для создания структуры и методологии для отбора участков, выбора участков и первоначальной характеристики участков геологического связывания углекислого газа, которые предоставляют заинтересованным сторонам сборник передовых методов; поделиться опытом, полученным в США

Источник: Национальная лаборатория энергетических технологий США

Дата: ноябрь 2010 г.

Этот атлас обновляет потенциал секвестрации углекислого газа (CO2) в Соединенных Штатах и ​​Канаде, а также предоставляет обновленную информацию о полевых мероприятиях региональных партнерств по секвестрации углерода (RCSP). Кроме того, в атласе указаны США


Источник: Национальная лаборатория энергетических технологий США

Этот сайт использует файлы cookie для повышения производительности. Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.

Настройка вашего браузера для приема файлов cookie

Существует множество причин, по которым cookie не может быть установлен правильно. Ниже приведены наиболее частые причины:

  • В вашем браузере отключены файлы cookie.Вам необходимо сбросить настройки своего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
  • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались. Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файлы cookie.
  • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
  • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie.Чтобы исправить это, установите правильное время и дату на своем компьютере.
  • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie. Вы должны отключить приложение при входе в систему или проконсультироваться с вашим системным администратором.

Почему этому сайту требуются файлы cookie?

Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.

Что сохраняется в файле cookie?

Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

Как правило, в файлах cookie может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

Гиалуронан голого землекопа с очень высокой молекулярной массой проявляет превосходные цитопротекторные свойства

Культура клеток

NSF и MSF были выделены в нашей лаборатории 43 из кожи молодых взрослых мышей ЯМР и мышей C57BL / 6J, соответственно. Фибробласты кожи выделяли из образцов кожи умерщвленных животных путем измельчения и переваривания их 0,14 единиц Вунча / мл Liberase TM (Roche Diagnostics) в среде DMEM / F12 при 37 ° C в течение 60 мин. Все животные содержались в соответствии с правилами, установленными и утвержденными Комитетом по животным ресурсам Университета Рочестера (UCAR), который придерживается рекомендаций FDA и NIH по уходу за животными и рассматривает все протоколы для животных до утверждения.Фибробласты легких человека IMR90 были получены из Института медицинских исследований Кориелла. Клетки HEK293T были из АТСС. Клетки NSF, MSF и IMR90 культивировали в EMEM с добавлением 15% FBS. NSF культивировали при 32 ° C, 4,8% CO 2 , 2,8% O 2 . Клетки MSF и IMR90 культивировали при 37 ° C, 5% CO 2 , 4% O 2 . Число пассажей клеток NSF, MSF и IMR90 было менее 20, 5 и 40 соответственно. В клетках IMR90 последовательность всех экзонов p53 была проверена с использованием наших данных RNA-Seq, и было обнаружено отсутствие мутаций.Подсчет клеток проводили с использованием чашек для культивирования с сеткой.

Анализ апоптоза

Апоптотические клетки определяли количественно с использованием набора для обнаружения апоптоза аннексина-V (eBioscience) в соответствии с инструкциями производителя. После окрашивания клетки анализировали с помощью проточного цитометра LSR-II (BD Biosciences).

Препарат НА

Для очистки НА кондиционированные среды сначала смешивали с раствором протеиназы К (конечные концентрации 1 мМ Трис-Cl pH 8,0, 2,5 мМ ЭДТА, 10 мМ NaCl, 0.05% SDS, 1 мг / мл протеиназы K) и инкубировали при 55 ° C в течение 4 часов. После переваривания белка среду экстрагировали насыщенным фенол-хлороформ-изоамиловым спиртом (Sigma). ГК осаждали этанолом и центрифугировали (4000 × г в течение 45 мин). Осадок НА растворяли в PBS и затем экстрагировали 1/100 объема Triton-X114 44 . После экстракции Triton-X114 HA снова осаждали этанолом. Наконец, осадок НА промывали 70% этанолом и растворяли в PBS. Для экстракции геля vHMM-HA NSF-HA запускали на 0.7% легкоплавкая агароза (бляшка Agarose-LM; Nacalai Tesque) в буфере TBE. Маркерную полосу отрезали от геля и окрашивали, как описано ниже. NSF-HA-содержащий гель с маркерной полосой выше 6,1 МДа был отрезан и vHMM-HA был выделен из геля с использованием термостабильной агаразы (ген Nippon) в соответствии с инструкциями производителя. Выделенный vHMM-HA затем экстрагировали PCI и Triton-X114 и осаждали этанолом, как описано выше. Концентрацию HA измеряли с помощью анализа карбазола 45 . Streptomyces. HAase (Sigma) использовали для деградации HA в кондиционированной среде и для частичной фрагментации HA. HA частично фрагментировали путем инкубации с 0,5 ед. / Мл HAase при 37 ° C в течение 60 минут с последующей тепловой инактивацией при 95 ° C в течение 10 минут. Select-HA TM был разработан Echelon Biosciences. Для блокирования взаимодействий HA / CD44 в культуральную среду добавляли нейтрализующее антитело CD44 (клон 2C5; R&D) в концентрации 10 нг / мл.

Экстракция РНК, обратная транскрипция и кПЦР в реальном времени

Полную РНК экстрагировали с помощью RNAiso Plus (Takara) и обратно транскрибировали в кДНК с помощью случайных гексамеров с использованием набора реагентов PrimeScript (Takara). КПЦР в реальном времени выполняли с использованием TB Green TM Premix Ex Taq II TM (Takara) с системой ПЦР в реальном времени Step ONE Plus (Life Technologies). В этом исследовании используются следующие праймеры: ACTB, вперед, AGATCAAGATCATTGCTCCTCCTG; ACTB обратный GCCGGACTCGTCATACTCCT; CD44 вперед, TGGTGAACAAGGAGTCGTCA; CD44 обратный, ACACCCCAATCTTCATGTCC; PRRX2 вперед, AGGTGCCTACGGTGAACTGA; PRRX2 обратный, CTGCCCCCTTTTCTATTGCT; PYCARD вперед, TGACGGATGAGCAGTACCAG; PYCARD реверс, CAGGCTGGTGTGAAACTGAA; RHAMM вперед, AGCAAGAAGGCATGGAGATG; RHAMM обратный, CCCTCCAGTTGGGCTATTTT; RRM2B вперед, GCCAGGACTCACTTTTTCCA; RRM2B обратный, TCCCTGACCCTTTCTTCTGA.

Гель-электрофорез в импульсном поле

Очищенную ГК смешивали с раствором сахарозы (конечная концентрация 333 мМ) и загружали в 0,4% -ный агарозный гель SeaKem Gold (Lonza). HA-Ladders (Hyalose) запускали вместе с образцами. Образцы обрабатывали 12 часов при 4 ° C и 75 В с рабочим соотношением 1–10 в буфере TBE с использованием системы CHEF-DRII (Bio-Rad). После эксперимента гель окрашивали 0,005% (мас. / Об.) Stains-All (Santa Cruz) в 50% этаноле в течение ночи. Затем гель дважды промывали 10% этанолом, подвергали воздействию света для уменьшения фона и фотографировали с помощью системы ChemiDoc Imaging System (Bio-Rad).

Иммунофлуоресцентное окрашивание

Клетки промывали PBS и фиксировали 4% формальдегидом при комнатной температуре в течение 15 мин. После фиксации клетки промывали 3% BSA / PBS и повышали проницаемость 0,5% Triton X-100 / PBS при комнатной температуре в течение 20 мин. Затем клетки промывали 3% BSA / PBS и блокировали блокирующим буфером (10% FBS и 1% BSA в PBS) при комнатной температуре в течение 1 часа. Затем клетки инкубировали с антителами γh3AX (JBW301; Millipore; 1: 500) и 53BP1 (ab172580; Abcam; 1: 500) в блокирующем буфере при 4 ° C в течение ночи и промывали PBST. Наконец, клетки инкубировали с козьим антителом против мышиного IgG Alexa Fluor 488 и козьим антителом против кроличьего IgG Alexa Fluor 568 (Thermo Fisher Scientific; 1: 1000) в блокирующем буфере при комнатной температуре в течение 1 ч, промывали PBST и помещали в Vectashield. содержащий DAPI (Vector Laboratories). Изображения были получены с помощью конфокального микроскопа Leica SP5.

Создание клеток IMR90 с избыточной экспрессией CD44

Клетки IMR90 с избыточной экспрессией CD44 и CD44-FLAG были установлены с помощью вирусной трансдукции и отбора пуромицина с концентрацией 1 мкг / мл.Клетки IMR90 со сверхэкспрессией CD44-FLAG дополнительно трансдуцировали ретровирусным вектором, несущим CD44-YFP, и отбирали с помощью FACS (Sony SH800). Ретровирусный супернатант получали путем котрансфекции клеток HEK293T с вектором VSV-G, pUMVC и pBabe-puro. Пустые векторы pBabe для экспрессии CD44s были получены от Addgene (№ 1764 и № 19127). CD44 были клонированы в pcDNA3.1-ZNF598-TEV-3xFLAG (# 105690, Addgene) и pcDNA3-YFP (# 13033, Addgene) для создания CD44-FLAG (C-конец) и CD44-YFP (C-конец), соответственно. .Затем CD44-FLAG и CD44-YFP клонировали обратно в вектор pBabe для продуцирования вируса.


Клетки инкубировали с 20 мкг / мл cNSF-HA, fNSF-HA или эквивалентным объемом PBS в течение 6 часов, затем среду удаляли и клетки перекрестно связывали в PBS, содержащем 500 мкМ DSP и 500 мкМ DSP. мкМ DTME (Thermo Fisher Scientific) в течение 30 мин при комнатной температуре. Сшивание гасили инкубацией с PBS, содержащим 20 мМ трис-Cl (pH 7,4) и 5 ​​мМ L-цистеин (Sigma). Клетки собирали в буфере RIPA (50 мМ Трис, pH 7.4, 150 мМ NaCl, 1% NP-40, 0,5% дезоксихолевая кислота, 0,1% SDS) с добавлением полного коктейля ингибиторов протеаз (Sigma). После лизиса клеток буфер заменяли 0,05% TBST с использованием колонки Vivaspin (MWCO = 10 кДа) (GE Healthcare). Иммунопреципитацию проводили из 200 мкг лизатов с 6 мкг антител против CD44 (3 мкг антитела Abcam против CD44 (каталожный ab157107) и 3 мкг антитела Proteintech против CD44 (каталожный 15675-1-AP)). нормальный кроличий IgG (Cell Signaling Technology), антитело против FLAG (M2; сигма) или нормальный мышиный IgG (CST) с использованием магнитных шариков Dynabeads Protein G (Thermo Fisher Scientific).Перед иммунопреципитацией антитела связывали с шариками с помощью DMP (Thermo Fisher Scientific). Иммунопреципитанты элюировали путем инкубации с буфером RIPA с добавлением 50 мМ DTT в течение 20 мин при 70 ° C.


CD44-иммунопреципитанты расщепляли трипсином и очищали с использованием колонки S-Trap (Protifi). Пептиды отправляли в Ресурсную лабораторию масс-спектрометрии Университета Рочестера для мечения 10-плексных ТМТ и масс-спектрометрии. Образцы разделяли ионизацией наноэлектрораспылением на приборе Orbitrap Fusion Lumos MS.Определение пептидов производили с использованием Proteome Discoverer и Sequest, а ионы MS3 использовали для количественной оценки содержания белка.

Анализ транскриптома


экстрагировали с использованием Trizol (Invitrogen). Образцы РНК были отправлены в Исследовательский центр геномики Университета Рочестера для RNA-Seq. Для создания библиотеки использовали комплект TruSeq RNA Sample Preparation Kit V2 (Illumina). Библиотеки гибридизовали с односторонней проточной кюветой Illumina и амплифицировали с использованием cBot (Illumina) в концентрации 8 пМ на дорожку.Для каждого образца были получены односторонние считывания по 100 нт. Секвенирование выполняли с использованием высокопроизводительного HiSeqTM 2500 компании Illumina. Нормализация и анализ дифференциальной экспрессии выполнялись с использованием DESeq2 46 . Онтологические анализы и анализ путей проводились с использованием программы Enrichr 26 . Анализ обогащения TFBS проводили с использованием программы oPOSSUM 27 . Параметры, использованные в oPOSSUM, были следующими: граница сохранения = 0,4, порог оценки матрицы = 85%, анализируемые последовательности = 2 т.п.н. перед сайтами начала транскрипции, отсечка по Z-баллу = 10, граничная оценка по шкале Фишера = 7.

Количественное определение внутриклеточных ROS

Количественное определение уровней внутриклеточных ROS проводили с использованием флуоресцентного зонда H 2 DCFDA. Клетки предварительно инкубировали в течение 6 часов с 20 мкг / мл NSF-HA или эквивалентным объемом PBS, затем с 5 мкМ H 2 DCFDA в HBSS в течение 30 минут, а затем подвергали воздействию 200 мкМ tBHP в течение 1 часа и промывают HBSS. Флуоресценцию DCF измеряли при возбуждении при Ex485 / Em530 нм и нормировали на количество клеток.


Лизаты целых клеток получали лизированием клеток в буфере для лизиса (20 мМ Трис, pH 7.5, 250 мМ NaCl, 1% N-лаурилсаркозин, 10 мМ NaF, 2 мМ ортованадат натрия, 1 мМ β-глицерофосфат) с добавлением коктейля комплексных ингибиторов протеаз (Sigma). Ядерные и цитоплазматические лизаты получали с использованием набора Nuclear Extract Kit (abcam, ab113474). Лизаты и иммунопреципитаты денатурировали при 95 ° C (70 ° C для обнаружения CD44) в течение 10 мин в буфере Лэммли. Белки разделяли с помощью SDS-PAGE, переносили на нитроцеллюлозные мембраны, блокировали 5% BSA или 5% молока в TBST в течение 1 часа и зондировали следующими первичными антителами: анти-β-актином (sc-47778; Santa Cruz), анти-CD44 (ab157107; abcam), анти-FLAG (M2; сигма), анти-GFP (для обнаружения YFP) (ab6556; abcam), анти-h4 (# 9715; CST), анти-p53 (человеческий) (10442 -1-AP; Proteintech), анти-p53 (мышиный) (ab26; Abcam), анти-фосфо-p53 (Ser-9) (# 9288; CST), анти-фосфо-p53 (Ser-15) (# 9286 ; CST), антифосфо-p53 (Ser-46) (# 2521; CST) и антифосфо-p53 (Thr-81) (# 2676; CST).Все первичные антитела разводили до 1 мкг / мл. После промывки TBST мембраны инкубировали со вторичными антителами (Sigma) (1: 1000) в течение 1 ч при комнатной температуре (RT), снова промывали TBST и визуализировали с помощью реагентов с усиленной хемилюминесценцией. Не обрезанные изображения гелей представлены на дополнительном рисунке 10.


RNAi получали путем трансфекции миРНК с использованием реагента для трансфекции RNAiMAX (Thermo Fisher Scientific). Конечная концентрация миРНК составляла 50 нМ.Последовательности олигонуклеотидов миРНК были следующими. си-люцифераза: CGUACGCGGAAUACUUCGAtt. si-CD44: GAACGAAUCCUGAAGACAUCUtt 47 . si-RHAMM: GCUAGAUAUUGCCCAGUUAtt 48 . si-p53: AAGACUCCAGUGGUAAUCUACtt 35 .

Статистика и воспроизводимость

Планки погрешностей представлены в виде среднего значения ± стандартное отклонение. Двусторонний тест Стьюдента t и односторонний дисперсионный анализ ANOVA с апостериорным двусторонним тестом Даннета использовали для оценки статистической значимости, если не указано иное.Точные значения p представлены в файле исходных данных. Все реплики являются биологическими.

Сводка отчетов

Дополнительная информация о дизайне исследования доступна в Сводке отчетов по исследованиям природы, связанной с этой статьей.

Партнерская экосистема — реселлеры | Maxar

Somos una empresa chilena de INGENIERÍA GEOSPACIAL, Experta en Geomática y Teledetección con una gran experiencecia en la prestación de servicios y productos de Geoinformación a las Principales empresas y actividales económicionesa de la de la de la de la de la de la de la de la de la de la de la zeñañaçala empresas yactivities comónómicisa de Eneridades.

Realizamos productos aplicados entre los cuales destacamos: Estudios Batimétricos, Estudios de medición de Calidad del Agua, Levantamientos Topográficos, Cartográficos, Estudios Medio Ambientales, Monitoreo и т. Д. ).

Nuestrocommoniso es prover a nuestros usuarios y clientes una solución integ a su necesidad específica, para lo cual ponemos a disición nuestro staff de profesionales altamente calificados en el processingamiento de productos de Geoinformación

Asimismo ,vestigamos y desarrollamos nuevas aplicaciones y metodologías que allowan mejorar sus productivos, operacionales y de seguridad utizando herramientas de teledetección

Мы — чилийская компания GEOSPACIAL ENGINEERING, эксперт в области геоматики и дистанционного зондирования с большим опытом в предоставлении геоинформационных услуг и продуктов основным компаниям и видам экономической деятельности, таким как: горнодобывающая промышленность, энергетика и государственные учреждения.

Мы выполняем прикладные продукты, среди которых мы выделяем: батиметрические исследования, исследования по измерению качества воды, топографические, картографические исследования, исследования окружающей среды, мониторинг и т. Д. С использованием спутниковых изображений, бортовых датчиков и / или БПЛА (беспилотных летательных аппаратов).

Наше обязательство — предоставить нашим пользователям и клиентам комплексное решение для их конкретных потребностей, для чего мы предоставляем наш штат высококвалифицированных профессионалов в области обработки геоинформационных продуктов.

Точно так же мы исследуем и разрабатываем новые приложения и методологии, которые позволяют улучшить ваши производственные, операционные процессы и процессы безопасности с помощью инструментов дистанционного зондирования.

Телефон: (56) 34 406003

Адрес: Inti 1867, Los Monjes II, Los Andes, Чили

Веб-сайт: www.gmgeomonitoring.com

Влияние добавок полиола / соли на лекарственное фазовое разделение и термодинамические свойства Triton X-100, Journal of Chemical & Engineering Data

Здесь мы исследовали влияние различных добавок [полиолов (глюкоза, галактоза и мальтоза) / электролитов (KCl, K 2 SO 4 и K 3 PO 4 · 7H 2 O)] о взаимодействии между хинолоновым антибиотиком, ципрофлоксацина гидрохлоридом (CFH) и тритоном X-100 (TX-100) с помощью метода измерения точки помутнения (CP).Было замечено, что величины CP TX-100 уменьшаются с увеличением концентрации TX-100. Значения CP показывают U-образное изменение в зависимости от концентрации CFH в водной среде. Значения CP уменьшаются из-за наличия электролита, что продолжается с увеличением концентрации электролита. Наблюдаемые значения CP в среде электролита соответствуют порядку CP K 3 PO 4 · 7H 2 O > CP K 2 SO 4 > CP KCl . ° 减少 与 TX-100 的 浓度。 浑浊 的 焓 值 ( ΔH c °) 和 浑浊 的 熵 值 (( ΔS c °) 热力学.传递 特性 , 均已 估算 和 详细 解释。 在 所有 情况 下 均 观察 到 出色 的 熵 — 焓 补偿。

Адипоцитокинов и клеток-предшественников CD34 + при болезни Альцгеймера



Болезнь Альцгеймера (БА) и атеросклероз имеют общий сосудистый риск такие факторы, как артериальная гипертензия и гиперхолестеринемия.Адипоцитокины и клетки-предшественники CD34 + связаны при прогрессировании и прогнозе атеросклеротических заболеваний. Их роль в AD недостаточно выяснены.

Методы и выводы

В настоящем исследовании мы измерили у 41 пациента с ранним БА и 37 возрастных групп. здоровые контролируют концентрацию адипонектина и крови в крови. лептин с помощью иммуноферментного анализа и CD34 + клетки-предшественники с использованием проточной цитометрии.Мы обнаружили значительно более низкую плазменную уровни лептина у пациентов с БА по сравнению с контролем, тогда как в плазме уровни адипонектина не показали каких-либо значительных различий (AD vs. контроль (среднее ± стандартное отклонение): лептин: 8,9 ± 5,6 нг / мл против 16,3 ± 15,5 нг / мл; P = 0,038; адипонектин: 18,5 ± 18,1 мкг / мл против 16,7 ± 8,9 мкг / мл; P = 0,641). Напротив, циркулирующие клетки CD34 + были значительно повышенная регуляция у пациентов с БА (среднее абсолютное количество клеток ± стандартное отклонение: 253 ± 51 против.203 ± 37; P = 0,02) и показал обратный корреляция с уровнем лептина в плазме (r = -0,248; P = 0,037).

При логистическом регрессионном анализе сниженная концентрация лептина (P = 0,021) и увеличение количества CD34 + клеток (P = 0,036) были оба существенно связано с наличием AD. В соответствии с многофакторный анализ ковариации, уровни лептина в сыворотке были значимый независимый предиктор количества CD34 + ячеек (P = 0.002).


Наши результаты показывают, что низкий уровень лептина в плазме и повышенное количество клеток-предшественников CD34 + оба связаны с AD. В Кроме того, результаты нашего исследования являются первым доказательством того, что увеличение уровни лептина в плазме связаны с уменьшением количества Клетки-предшественники CD34 + у пациентов с БА. Эти выводы указывают на совместное участие лептина и CD34 + клетки-предшественники в патогенезе БА.Таким образом, уровни лептина в плазме и циркулирующие клетки-предшественники CD34 + могут представлять собой важная молекулярная связь между атеросклеротическими заболеваниями и БА. Способствовать исследования должны прояснить патофизиологическую роль обоих адипоцитокинов. и клетки-предшественники при БА и возможные диагностические и терапевтические Приложения.

Образец цитирования: Бигалке Б., Шрайтмюллер Б., Сопова К., Пауль А., Странски Е., Гаваз М. и др.(2011) Адипоцитокины и клетки-предшественники CD34 + в Болезнь Альцгеймера. PLoS ONE 6 (5): e20286. https://doi.org/10.1371/journal.pone.0020286

Редактор: Мария А. Дели, Центр биологических исследований Венгерской академии наук, Венгрия

Поступила: 18.01.2011; Одобрена: 28 апреля 2011 г .; Опубликовано: 25 мая 2011 г.

Авторские права: © 2011 Bigalke et al.Это статья в открытом доступе, распространяется под условия лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии, что первоначальный автор и источник указаны.

Финансирование: Исследование было частично поддержано грантами программы Fortüne Тюбингенский университет F1331299 в CL и 1795-1-0 в KS (Константинос Stellos) из гранта Немецкого кардиологического общества (DGK) «молекулярная визуализация атерослеротических бляшек на BB, от Hirnliga e.В. к КС (Константинос Стеллос) и от Немецкого исследовательского фонда (Deutsche Forschungsgemeinschaft; DFG: Li849 / 3-1; SFB: SFB-TR19-B8N) Sonderforschungsbereich / Transregio-19 «Воспалительная кардиомиопатия — Молекулярный патогенез и лечение »К.С. (Константинос Стеллос) и М.Г. Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решений. опубликовать или подготовить рукопись.

Конкурирующие интересы: Авторы заявили, что никаких конкурирующих интересов не существует.


Было обнаружено, что повышенные уровни лептина в плазме связаны с более низким риском случайное слабоумие и болезнь Альцгеймера (БА) [1]. Цереброваскулярная дисфункция — это хорошо известная находка у пациентов с БА [2], и лептин может быть важная терапевтическая мишень [3]. Несмотря на то, что уровни адипоцитокинов, лептина и плазмы крови адипонектин связаны с прогрессированием и прогнозом атеросклеротического заболевания, у которых наблюдается значительный рост у пациентов с острым коронарным синдромом по сравнению с пациентами со стабильной стенокардией [4] оценка Уровни адипоцитокинов в плазме у пациентов с БА требуют дальнейшего выяснения из-за контрастирующие результаты концентраций адипоцитокинов в плазме [5].

г. н.э. и атеросклероз имеют общие классические церебро- / сердечно-сосудистые факторы риска. такие как гипертония, гиперлипидемия, сахарный диабет 2 типа, ожирение и курение [6]. Рассмотрение этого сосудистого компонента при БА позволяет нам найти ключевые аспекты, в том числе: эпидемиология, генетика, патогенез, диагностика и лечение с аналогичной точки зрения к ишемической болезни сердца (ИБС) [7]. Ранее наша группа описывала ассоциации уровни в плазме тромбоцитов растворимого гликопротеина рецептора коллагена VI (GPVI) а также фактора 1, производного от стромальных клеток (SDF-1), у пациентов с БА [8], [9].У нас недавно показано, что клетки-предшественники CD34 + имеют повышенную регуляцию в зависимости от стадии у пациентов с БА [10], что может отражать процессы восстановления сосудов в головном мозге. [11]. Несколько исследования изучали ассоциации адипоцитокинов и клеток-предшественников и были сосредоточены на их сосудистые эффекты у пациентов с острым инфарктом миокарда и с метаболический синдром [12] — [14]. На сегодняшний день ни одно исследование не фокусировалось на наличии AD и потенциальная связь между адипоцитокинами и количеством CD34 + клетки-предшественники у пациентов с БА.Несмотря на то, что нейродегенерация AD, инсульт, и ИБС имеют схожие механизмы восстановления сосудов [15], разные уровни и терапевтические эффекты клеток-предшественников в регенерации сосудов противоречивые результаты сердечно-сосудистых исследований [16], [17].

Что касается пациентов с ИБС, дифференциальные концентрации адипонектина в плазме крови был спорно обсуждается прогностическое значение [4], [18] — [20]. Более того, адипонектин, кажется, действуют защитным образом при сопутствующих заболеваниях, таких как сахарный диабет 2 типа, инсулин резистентность, метаболический синдром и воспаление [21] — [23], тогда как корреляции лептина к классическим маркерам риска, таким как тропонин-I и С-реактивный белок, могут отражают степень воспаления в процессе нестабильности бляшки [24].

Целью этого исследования было дифференциально оценить наличие БА и найти ассоциации между уровнями в плазме обоих адипоцитокинов (лептина и адипонектин) и их влияние на количество предшественников CD34 + клетки, отражающие начало процесса заживления сосудов в головном мозге пациентов с AD.



Мы последовательно обследовали 41 пациента с ранним БА из нашей Клиники памяти в Университетская клиника психиатрии и психотерапии Тюбингена и сравнил их 37 здоровым пожилым людям.Демографические и клинические данные пациентов Подробности представлены в Таблице 1 .

Пациенты с БА соответствовали критериям МКБ-10, DSM-IV и Национальным Институт неврологических и коммуникативных расстройств и инсульта и Ассоциация болезни Альцгеймера и связанных с ней заболеваний (NINCDS-ADRDA) для вероятная AD [25]. Клиническая тяжесть когнитивных нарушений была оценивается по краткой шкале психического состояния (MMSE) [26].

пациентов с AD или контрольных субъектов с текущей или историей депрессии или психоз с серьезным физическим заболеванием, злоупотреблением алкоголем или психоактивными веществами или употреблением психоактивные препараты были исключены из исследования.

Исследование выполнено в соответствии с этическими принципами Декларации Хельсинки (шестая редакция, 2008 г.) и была одобрена местным комитетом по этике. Университетской клиники Тюбингена.Мы получили письменное информированное согласие от все субъекты, участвовавшие в исследовании (в случае пациентов с БА: сами по себе или законными представителями).

Забор крови

Кровь брали утром (с 9.00 до 10.00, натощак). государственный). Венозную кровь заполняли 5 мл этилендиаминтетрауксусной кислоты (ЭДТА). зонды плазмы для определения исходных концентраций адипонектина, и лептин с использованием набора для твердофазного иммуноферментного анализа (ELISA), а также в 3.Пробирки с 8% цитратной плазмой для моноядерных клеток периферической крови изоляция.

Проточная цитометрия

В соответствии с предыдущими протоколами мононуклеарные клетки выделяли с использованием Ficoll градиент плотности (Biocoll, Biochrom, Берлин, Германия) [10], [27]. Мононуклеарные клетки были ресуспендировали в 100 мкл забуференного фосфатом физиологического раствора. Для проточной цитометрии analyis, мы использовали антитела к CD34, конъюгированные с флуоресцеином (FITC) (Becton Дикинсон, Сан-Хосе, США; клон 8G12) и IgG1-FITC (BD Biosciences Pharmingen, США; clone MOPC-21) служил в качестве отрицательного изотипического контроля.Каждое измерение было выполняется в двух экземплярах. После 250 000 событий в лимфоците ворот, мы использовали абсолютное количество ячеек в качестве единиц.


Уровни адипонектина и лептина в плазме крови были определены в общей группе из 78 человек. последовательные пациенты с БА и здоровые люди из контрольной группы с использованием коммерчески доступного Набор для ELISA в соответствии с инструкциями производителя (R&D Systems, Миннеаполис, Миннесота, США).Зонды плазмы с ЭДТА центрифугировали в течение 15 минут при 10 000 г в течение 30 минут после сбора. Зонды были разделены на аликвоты и хранились в −20 ° C перед анализом. Нижние пределы обнаружения этих анализов были 15,6 пг / мл для лептина и 0,079 нг / мл для адипонектина. Эти тесты распознают рекомбинантный и природный лептин и рекомбинантный и природный (низкий, средний и высокий молекулярная масса) общий адипонектин человека.

Анализ данных

Данные представлены как среднее ± стандартное отклонение (SD). Все тесты были двусторонняя и статистическая значимость считалась для значений P меньше, чем 0,05. Для исправлений многократного тестирования используется поправка Бонферрони – Холма. был применен. Множественный логистический регрессионный анализ, реализующий автоматический Поэтапный алгоритм выбора включения факторов риска проводился для оценки независимая ассоциация параметров с наличием AD.Корректировка возможных искажающих факторов был выполнен многофакторным анализом ковариации для десятичного логарифма уровней лептина и адипонектина в плазме и количество клеток-предшественников CD34 + соответственно. Пациенты подобраны по возрасту, полу, массе тела, классическим факторы риска церебро- / сердечно-сосудистых заболеваний, сопутствующие заболевания и лечение относительно ингибиторов ангиотензинпревращающего фермента (АПФ), статинов и нестероидные противовоспалительные препараты.Непрерывные переменные были протестированы на нормальное распределение с тестом Колмогорова-Смирнова. Двусторонний t-тест был используется для оценки различий между двумя группами в случае нормального распределения. U-критерий Манна-Уитни использовался для оценки различий между двумя группами в случай ненормального распределения. Сравнение категориальных переменных было генерируется критерием хи-квадрат Пирсона. Корреляции оценивались с помощью Проверка коэффициента корреляции Спирмена данных.Все статистические анализы были выполняется с помощью компьютерной программы SPSS версии 15.0.1 для windows (SPSS Inc., Чикаго, Иллинойс, США).


Мы последовательно обследовали 41 пациента с ранним БА (22 женщины, 19 мужчин; средний возраст ± SD: 74,3 ± 9,1 года) и сравнили их с 37 здоровыми пожилыми людьми в контрольной группе. (18 женщин, 19 мужчин; средний возраст ± стандартное отклонение: 67,3 ± 10,2 года). Пациенты с БА показали средний балл по шкале MMSE ± стандартное отклонение 19.8 ± 4.5. Контрольная группа имела нормальный когнитивный статус согласно клиническому обследованию и баллу MMSE (средний балл MMSE ± SD: 29,4 ± 0,6). Демографические и клинические данные пациентов представлены в таблице 1 .

Мы обнаружили значительно более низкие уровни лептина в плазме у пациентов с БА по сравнению с здоровый контроль ( Рис. 1A ) , тогда как уровни в плазме адипонектин не показал каких-либо значительных различий (AD vs.контроль (среднее ± стандартное отклонение): лептин: 8,9 ± 5,6 нг / мл против 16,3 ± 15,5 нг / мл; P = 0,038; адипонектин: 18,5 ± 18,1 мкг / мл vs. 16,7 ± 8,9 мкг / мл; P = 0,641) ( рис. 1Б ) . Однако уровни в плазме обоих адипоцитокины значительно коррелировали друг с другом (r = 0,402; P = 0,001) в комбинированном выборка пациентов с БА и контрольной группы.

Рисунок 1. Уровни адипоцитокинов, лептина и адипонектина в плазме, а также количество CD34 + клеток-предшественников при болезни Альцгеймера (ОБЪЯВЛЕНИЕ).

(A) Пациенты с БА показали значительно более низкие уровни лептина в плазме по сравнению с здоровый контроль (P = 0,038). (B) Уровни плазмы адипонектин не показал каких-либо значительных различий между пациентами с БА и здоровый контроль (P = 0,641). (C) Количество CD34 + клеток-предшественников [среднее абсолютное значение клетки count] был значительно повышен у пациентов с AD по сравнению с контроль (P = 0.02). (D) Уровни лептина в плазме обратно коррелирует с количеством предшественников CD34 + клетки (r = −0,248; P = 0,037).


Количество циркулирующих клеток-предшественников CD34 + было значительно повышенная регуляция у пациентов с БА (среднее абсолютное количество клеток ± стандартное отклонение: 253 ± 51 vs. 203 ± 37; P = 0,02) ( рис.1С ) . Более того, мы обнаружили значительную обратную корреляцию с уровнями в плазме лептин (r = -0,248; P = 0,037) ( рис. 1D ) .

Чтобы проверить, соответствуют ли уровни адипоцитокинов (лептин, адипонектин) и Клетки-предшественники CD34 + независимо связаны с наличие AD, мы выполнили многомерный логистический регрессионный анализ, включая параметры, такие как возраст, пол, классические церебро- / сердечно-сосудистые факторы риска, сопутствующие заболевания и лекарства.Среди проверенных переменных уровни лептина в плазме были отрицательно (P = 0,021) и количество CD34 + клетки-предшественники положительно (P = 0,036) ассоциированы с наличие AD (Таблица 2 ) .

Сравнение десятичного логарифма плазменных уровней лептина, адипонектина и Клетки CD34 + между AD и контролем были скорректированы возможным мешающие факторы, такие как возраст, пол, масса тела, классический церебро- / сердечно-сосудистый риск факторы, сопутствующие заболевания и лечение.Таким образом, уровни лептина и Клетки CD34 + были независимо связаны с БА по сравнению с контрольной группе (лептин: P = 0,002; CD34 + клетки: P = 0,022), в то время как уровни адипонектина в плазме крови не наблюдались. связаны с AD (P = 0,470) и не подвергались никакому влиянию другие потенциальные искажающие факторы (все, P> 0,05) ( Таблица 3 ) .

Уровни лептина в плазме достоверно коррелировали с тяжестью БА в соответствии с Оценка MMSE (r = 0.264; P = 0,019) ( рис. 2A ) , тогда как повышенные уровни в плазме адипонектин показал обратную тенденцию к более низкому баллу MMSE, хотя этого не произошло. достичь статистически значимого уровня (r = −0,137; P = 0,062). Более того, высокий уровень лептина в плазме положительно коррелировал с повышенным индексом массы тела (ИМТ) (r = 0,428; P = 0,001) ( Рис.2B ) , и обратно коррелирует с возрастом (r = -0,225; P = 0,048) ( Рис. 2C ) . Однако высокий уровень адипонектина не коррелировал с ИМТ. (r = 0,119; P = 0,314) или с возрастом, соответственно (r = 0,099; P = 0,396).

Рисунок 2. Корреляция исходных концентраций лептина по данным мини-психологии. оценка государственного экзамена (MMSE).

(A) Более низкие уровни лептина в плазме достоверно коррелировали с более низким MMSE балл (r = 0,264; P = 0,019). (В) Высокий уровень лептина в плазме положительно коррелирует с увеличением массы тела. индекс (ИМТ) (r = 0,428; P = 0,001) и (C) обратно коррелирует с возрастом (r = -0,225; P = 0,048).



Основными выводами настоящего наблюдательного исследования являются: 1) пациенты с БА имели значительно снизился уровень лептина в плазме крови по сравнению со здоровым контролем, тогда как циркулирующие клетки CD34 + были значительно активированы при БА. пациенты; 2) в логистическом регрессионном анализе снижение концентрации лептина и повышенное количество клеток CD34 + , оба были значительно связаны с наличием АД; 3) высокий уровень лептина в плазме обратно коррелирует с более низкий балл по шкале MMSE и более высокий возраст, что положительно коррелирует с увеличением ИМТ.

Адипоцитокины, лептин и адипонектин, связаны с заболеваемостью, прогрессированием и исход атеросклеротических заболеваний, хотя предыдущие исследования предоставили контрастирующие результаты о дифференциальных концентрациях адипоцитокинов в плазме при ИБС, ишемическом инсульте и БА [4], [5], [18] — [20], [28], [29]. Недавно было описано, что циркулирующий лептин связаны со снижением заболеваемости деменцией и АД и с более высоким общим объем головного мозга, определенный с помощью магнитно-резонансной томографии у бессимптомных пожилых людей взрослые [1].Эти результаты, предполагающие защитную роль лептина, были подтверждены нашими выводами с снижение исходного уровня лептина в плазме у пациентов с БА по сравнению со здоровыми контролирует. Кроме того, уменьшение циркулирующего лептина также может иметь пагубные последствия. влияние на тяжесть когнитивной дисфункции, определяемой по шкале MMSE.

Насколько нам известно, потенциальная связь между адипоцитокинами и о количестве клеток-предшественников у пациентов с БА пока не сообщалось.Несколько in vivo эксперименты показали, что лептин может значительно увеличить набор гематопоэтических, а также эндотелиальных клеток-предшественников и способствуют регенерации сосудов после сосудистого повреждения [30] — [32]. Как ангиогенный фактор, лептин вызывает неоваскуляризацию, а также проницаемость сосудов [33], [34]. Более того, лептин может регулировать клетки-предшественники гиппокампа, усиливая нейрогенез в взрослые мыши [35].В У пациентов с БА мы недавно сообщили об увеличении количества циркулирующих CD34 + / CD133 + клеток-предшественников у пациентов с деменция от умеренной до тяжелой [10]. В настоящем исследовании мы могли бы продемонстрировать обратный корреляция между снижением уровня лептина в плазме и повышением циркуляции CD34 + клеток-предшественников. Этот вывод согласуется с результатами недавнего исследования с участием пациентов с ожирением и может быть связано с отрицательной обратной связью. механизм проангиогенных факторов [13].

Хотя уровни адипонектина в плазме часто исследовались в предыдущих исследования ИБС и ишемического инсульта [4], [15] — [17], [26], ни одно из них не было сосредоточено на пациентах с AD пока что. Таким образом, мы обнаружили, что адипонектин не был связан с БА. на него также не повлияли какие-либо другие возможные факторы. Однако уровни в плазме адипонектин обратно коррелирует с оценками MMSE, хотя они не достигли статистически значимый уровень.Интересно, что уровни обоих адипоцитокинов в плазме крови существенно коррелировали друг с другом, что было описано ранее в пациенты с ИБС [4]. Как известно, патологические изменения в головном мозге когнитивная дисфункция связана с возрастным снижением [36]. Кроме того, возраст известен как основной фактор риска БА [36]. Интересно, что мы нашли значимая обратная корреляция между уровнем лептина в плазме и возрастом в целом изучить популяцию пациентов с БА и здоровых людей из контрольной группы.Этот результат показывает, что уровни лептина в плазме снижаются с возрастом, возможно, в непрерывном достигает своей кульминации с AD. Кроме того, потеря веса часто предшествует деменции у пациентов с БА. [37] и ИМТ, гиперлипидемия и сахарный диабет оказывают значительное влияние на экспрессию лептин и адипонектин [37], [38]. Однако связь лептина с ИМТ или оценкой MMSE дали противоречивые результаты, которые в некоторых случаях можно объяснить лептином резистентность у тучных людей [39] — [41].Наш коллектив показал, что высокий уровень лептина в плазме положительно коррелировал с повышенным ИМТ.

Предыдущие исследования показали, что лептин может быть напрямую связан с БА. патология в головном мозге [1], [6], [42]. Два основных признака молекулярного патогенеза БА. представляют собой накопление пептидов бета-амилоида (Aβ) в амилоидных бляшках и отложение гиперфосфорилированных тау-белков в нейрофибриллярные клубки [6]. Недавние экспериментальные исследования на животных моделях БА показали, что диеты, обогащенные холестерином, и холестерин метаболиты увеличивают уровни Aβ и фосфорилированного тау в головном мозге за счет снижения уровни лептина [42].Таким образом, лечение лептином полностью изменило индуцированный 27-OHC увеличение Aβ и фосфорилированного тау за счет снижения уровней β-секретаза (BACE-1) и киназа-3β гликоген синтетазы (GSK-3β) соответственно [42]. Защитный эффект от приема лептина Патология БА в головном мозге также была продемонстрирована в других экспериментальных исследованиях. [43]. Эти экспериментальные данные показывают, что введение лептина может быть многообещающим новым стратегия лечения против AD.

Кроме того, адипоцитокины могут использоваться в качестве диагностического инструмента для определения мультимаркера. стратегия при БА с одновременной оценкой биомаркеров, таких как эндотелин-1, предсердный натрийуретический пептид и адреномедуллин с иммуномодулирующими, метаболическими и сосудистые характеристики [44]. Разработка и оценка панели мультимаркеров активность тромбоцитов, восстановление сосудов и регенерация тканей могут быть полезными, поскольку мы ранее обнаружили связь уровней в плазме растворимых веществ, полученных из тромбоцитов. GPVI, SDF-1 и CD34 + / CD133 + клетки-предшественники с Пациенты с БА [8] — [10].

В заключение, наши данные свидетельствуют о том, что низкие уровни лептина в плазме и повышенные Обе клетки-предшественники CD34 + связаны с AD. В Кроме того, результаты нашего исследования являются первым доказательством того, что повышенный уровень лептина уровни в плазме связаны со сниженным количеством CD34 + клетки-предшественники у пациентов с БА. Эти результаты указывают на совместное участие лептина и клеток-предшественников CD34 + в патогенезе БА.Таким образом, уровни лептина и циркулирующих клеток-предшественников CD34 + в плазме крови может представлять собой важную молекулярную связь между атеросклеротическими заболеваниями и БА. Дальнейшие исследования должны прояснить патофизиологическую роль и взаимодействие обоих адипоцитокины и клетки-предшественники при БА и возможные диагностические и терапевтические Приложения.


Благодарим Антонию Колмар за техническую помощь.

Вклад авторов

Эксперимент задумал и разработал: BB K. Stellos CL. Выполнил эксперименты: ES AP. Проанализированы данные: BB BS K. Stellos CL. Внесенный реагенты / материалы / инструменты анализа: Сопова К.Г. КЛ. Написал бумагу: BB.

Список литературы

  1. 1. Либ В., Байзер А.С., Васан Р.С., Тан З.С., Ау Р. и др. (2009) Связь уровней лептина в плазме с болезнью Альцгеймера Заболевания и МРТ-методы старения мозга.JAMA 302: 2565–2572.
  2. 2. Becker-Barroso E (2005) Дополнительная поддержка сосудистой основы болезни Альцгеймера болезнь. Lancet Neurol 4: 598–599.
  3. 3. Tezapsidis N, Johnston JM, Smith MA, Ahford JW, Casadesus G и др. (2009) Лептин: новая терапевтическая стратегия от болезни Альцгеймера. болезнь. J Alzheimers Dis 16: 731–740.
  4. 4. Бигалке Б., Стеллос К., Гейслер Т., Сейзер П., Мозес В. и др. (2010) Высокие уровни адипоцитокинов в плазме связаны с тромбоцитами. активация у пациентов с ишемической болезнью сердца.Тромбоциты 21: 11–9.
  5. 5. Джордано В., Пелусо Г., Яннучелли М., Бенатти П., Николай Р. и др. (2007) Системная и метаболическая дисфункция головного мозга как новая парадигма для Приближение к слабоумию Альцгеймера. Neurochem Res 32: 555–567.
  6. 6. Blennow K, de Leon MJ, Zetterberg H (2006) Болезнь Альцгеймера. Ланцет 368: 387–403.
  7. 7. Оцука Ф., Сугияма С., Кодзима С., Маруёси Х., Фунахаши Т. и др. (2006) Уровни адипонектина в плазме связаны с поражением коронарных артерий. сложность у мужчин с ишемической болезнью сердца.J Am Coll Cardiol 48: 1155–62.
  8. 8. Ласке С., Лейхе Т., Странски Э., Эшвайлер Г.В., Бультманн А. и др. (2008) Ассоциация растворимого гликопротеина VI тромбоцитов в плазме при болезни Альцгеймера. J Psychiatr Res 42: 746–51.
  9. 9. Laske C, Stellos K, Eschweiler GW, Leyhe T, Gawaz M (2008) Сниженные уровни плазмы CXCL12 (SDF-1) при ранней стадии болезни Альцгеймера Болезнь. Вклад в дефицит кроветворного мозга Служба поддержки? J Alzheimers Dis 15: 83–95.
  10. 10. Stellos K, Panagiota V, Sachsenmaier S, Trunk T, Straten G и др. (2010) Увеличение тиражей CD34 + / CD133 + клеток-предшественников в Пациенты с болезнью Альцгеймера с деменцией средней и тяжелой степени: доказательства для восстановления сосудов и регенерации тканей? J. Alzheimers Dis 19: 591–600.
  11. 11. Xu Q (2007) Клетки-предшественники в восстановлении сосудов. Curr Opin Lipidol 18: 534–9.
  12. 12. Сибата Р., Нумагути Ю., Мацусита К., Соне Т., Кубота Р. и др. (2008) Полезность адипонектина для прогнозирования спасения миокарда после успешная реперфузия у пациентов с острым миокардиальным инфаркт. Am J Cardiol 101: 1712–5.
  13. 13. Tobler K, Freudenthaler A, Baumgartner-Parzer SM, Wolzt M, Ludvik B, et al. (2010) Снижение как численности, так и пролиферативной активности человека эндотелиальные клетки-предшественники при ожирении.Int J Obes (Лондон) 34: 687–700.
  14. 14. Wolk R, Deb A, Caplice NM, Somers VK (2005) Рецептор лептина и функциональные эффекты лептина у человека эндотелиальные клетки-предшественники. Атеросклероз 183: 131–9.
  15. 15. Салмина А.Б., Инжутова А.И., Малиновская Н.А., Петрова М.М. (2010) Эндотелиальная дисфункция и восстановление при болезни Альцгеймера нейродегенерация: нейрональный и глиальный контроль. J Alzheimers Dis 22: 17–36.
  16. 16.Шехингер В., Эрбс С., Эльзассер А., Хабербош В., Хамбрехт Р. и др. (2006) Интракоронарные клетки-предшественники костного мозга при остром инфаркт миокарда. N Engl J Med 355: 1210–21.
  17. 17. Лунде К., Сольхейм С., Аахус С., Арнесен Х., Абдельнор М. и др. (2006) Интракоронарная инъекция мононуклеарных клеток костного мозга при остром инфаркт миокарда. N Engl J Med 355: 1199–209.
  18. 18. Cavusoglu E, Ruwende C, Chopra V, Yanamadala S, Eng C, et al.(2006) Адипонектин — независимый предиктор смертности от всех причин, сердечная смертность и инфаркт миокарда у пациентов с грудная боль. Eur Heart J 27: 2300–9.
  19. 19. Schnabel R, Messow CM, Lubos E, Espinola-Klein C, Rupprecht HJ, et al. (2008) Связь адипонектина с неблагоприятным исходом в коронарной артерии. Пациенты с заболеваниями артерий: результаты исследования AtheroGene. Eur Heart J 29: 649–57.
  20. 20. Broedl UC, Lebherz C, Lehrke M, Stark R, Greif M и др. (2009) Низкий уровень адипонектина является независимым предиктором смешанного и некальцифицированные коронарные атеросклеротические бляшки. PLoS ONE 4: e4733.
  21. 21. Шпрангер Дж., Кроке А., Мёлиг М., Бергманн М.М., Ристоу М. и др. (2003) Адипонектин и защита от диабета 2 типа mellitus. Ланцет 361: 226–8.
  22. 22. Мацузава Y, Фунахаши T, Kihara S, Shimomura I (2004) Адипонектин и метаболический синдром.Артериосклер Thromb Vasc Biol 24: 29–33.
  23. 23. Fantuzzi G (2008) Адипонектин и воспаление: консенсус и полемика. J Allergy Clin Immunol 121: 326–30.
  24. 24. Dubey L, Zeng H, Hashmi S, Hongjie W, Tao H (2008) Ассоциация уровней лептина в плазме и сложности виновника поражение у больных нестабильной стенокардией. Int J Cardiol 126: 183–9.
  25. 25. Маккханн Г., Драхман Д., Фолштейн М., Кацман Р., Прайс Д. и др.(1984) Клинический диагноз болезни Альцгеймера: отчет Рабочая группа NINCDS-ADRDA под эгидой Министерства здравоохранения и человека Целевая группа служб по болезни Альцгеймера. Неврология 34: 30–4.
  26. 26. Фолштейн М.Ф., Фолштейн С.Е., МакХью П.Р. (1975) «Мини-психическое состояние». Практический метод выставления оценок когнитивное состояние пациентов для клинициста. J Psychiatr Res 12: 189–98.
  27. 27.Стеллос К., Бигалке Б., Лангер Х., Гейслер Т., Шад А. и др. (2009) Экспрессия фактора-1, полученного из стромальных клеток, в циркулирующей тромбоцитов повышено у пациентов с острым коронарным синдромом и коррелирует с количеством клеток-предшественников CD34 +. Eur Heart J 30: 584–93.
  28. 28. Валерио А., Доссена М., Бертолотти П., Бетони Ф., Сарнико Н. и др. (2009) Лептин индуцируется в ишемической коре головного мозга и оказывает нейропротекция через NF-κB / c-Rel-зависимую транскрипция.Ход 40: 610–17.
  29. 29. Маруси С.Г., Теодору Г.Л., Караканца М., Зампакис П., Папатанасопулос П. и др. (2009) Острый постинсультный адипонектин в зависимости от тяжести инсульта, прогрессирование и 6-месячный функциональный результат. Neurol Res. [epub перед печатью].
  30. 30. Гейнсфорд Т., Уилсон Т.А., Меткалф Д., Хэндман Э., Макфарлейн С. и др. (1996) Лептин может вызывать пролиферацию, дифференцировку и функциональную активация кроветворных клеток.Proc Natl Acad Sci USA 93: 14564–8.
  31. 31. Schroeter MR, Leifheit M, Sudholt P, Heida NM, Dellas C, et al. (2008) Лептин усиливает набор эндотелиальных клеток-предшественников. в неоинтимальные поражения после сосудистого повреждения путем стимулирования опосредованного интегрином адгезия. Circ Res 103: 536–44.
  32. 32. Умемото Ю., Цуджи К., Ян Ф.К., Эбихара Ю., Канеко А. и др. (1997) Лептин стимулирует пролиферацию миелоцитов мышей и примитивные кроветворные клетки-предшественники.Кровь 90: 3438–43.
  33. 33. Cao R, Brakenhielm E, Wahlestedt C, Thyberg J, Cao Y (2001) Лептин индуцирует проницаемость сосудов и синергетически стимулирует ангиогенез с помощью FGF-2 и VEGF. Proc Natl Acad Sci USA 98: 6390–5.
  34. 34. Сьерра-Хонигманн М.Р., Нат А.К., Мураками К., Гарсия-Кардена Г., Папапетропулос А. и др. (1998) Биологическое действие лептина как ангиогенного фактор. Science 281: 1683–6.
  35. 35.Garza JC, Guo M, Zhang W, Lu XY (2008) Лептин увеличивает нейрогенез гиппокампа у взрослых in vivo и in vivo. пробирка. J Biol Chem 2008 283: 18238–47.
  36. 36. Савва GM, Wharton SB, Ince PG, Forster G, Matthews FE и др. (2009) Возраст, невропатология и деменция. N Engl J Med 360: 2302–09.
  37. 37. Хара К., Ямаути Т., Имаи Й, Манабе И., Нагаи Р. и др. (2007) Пониженный уровень адипонектина связан с серьезностью коронарного заболевание артерий.Int Heart J 48: 149–53.
  38. 38. Wallander M, Söderberg S, Norhammar A (2008) Лептин: предиктор аномальной толерантности к глюкозе и прогноза у пациентов с инфарктом миокарда и без ранее известного типа 2 сахарный диабет. Diabet Med 25: 949–55.
  39. 39. Fewlass DC, Noboa K, Pi-Sunyer X, Johnston JM, Yan SD и др. (2004) Связанный с ожирением лептин регулирует болезнь Альцгеймера. Aβ. FASEB J 18: 1870–8.
  40. 40. Атти А.Р., Палмер К., Вольпато С., Винблад Б., Де Ронки Д. и др. (2008) Индекс массы тела в позднем возрасте и заболеваемость деменцией: девять лет. последующие данные проекта Kungsholmen. J Am Geriatr Soc 56: 111–6.
  41. 41. Ганстад Дж., Шпицнагель М.Б., Кири Т.А., Гликман Э., Александр Т. и др. (2008) Уровни лептина в сыворотке связаны с когнитивной функцией у пожилые люди. Brain Res 1230: 233–6.
  42. 42.Marwarha G, Dasari B, Prasanthi JR, Schommer J, Ghribi O (2010) Лептин снижает накопление Aβ и фосфорилированного тау индуцируется 27-гидроксихолестерином у кроликов по органотипическим ломтики. J Alzheimers Dis 19: 1007–19.
  43. 43. Греко С.Дж., Брайан К.Дж., Саркар С., Чжу Х, Смит М.А. и др. (2010) Хронический прием лептина облегчает патологию и улучшает Когнитивные способности в модели болезни Альцгеймера на трансгенных мышах Болезнь.J.

Добавить комментарий

Ваш адрес email не будет опубликован.