Павел ерохин одежда официальный сайт: Купить Pavel Yerokin в интернет-магазине на Lookshops.ru

Автор: | 25.07.2020


История бренда Doctor E

Doctor E — российский бренд дизайнерской одежды. Свою букву Е в название бренда подарил его основатель дизайнер Павел Ерохин. Произошло это в 1999 году, именно тогда молодой доктор Ерохин решил резко поменять сферу деятельности и стал модельером-дизайнером.

Не сразу, но начинающий модельер нарабатывал опыт и зарабатывал имя. Уже в первые годы нового века его модели демонстрируются на подиумах высокой моды России. Ерохин со своими коллекциями участвует неоднократно в Неделях русской моды и Московской неделе моды. К 2009 году марка Doctor E становится известной и популярной. В 2011 году Павел Ерохин со своими работами выступает в Милане, на фестивале, знакомящих итальянцев с модой из России.

Разрабатывая первые коллекции, бывший доктор Ерохин нацеливался на жителя мегаполиса, делового, целеустремленного и смелого. Эклектичная и яркая одежда нового бренда соответствовала духу современных модных тенденций и ориентировалась не на какие-то особые случаи, а на повседневную жизнь горожанина, добавляя в нее красок и радости. По словам дизайнера, его одежда для тех, кто не боится выделиться из толпы. Его девиз: «Модная одежда — это одежда для индивидуальностей». И скоро одежду нового бренда носили известные артисты и музыканты, популярные телеведущие, что лишь добавляло ей известности. В нарядах от Doctor E выходили на сцену и конкурсанты «Новой волны» в 2011 году.

Но продукция модного бренда — это не просто коллекции модной одежды для показов, это полноценный промышленный дизайн изделий. Сегодня это серьезное производство, где несколько цехов: джинсовый и трикотажный, а также — современная оснащенная лаборатория, которые обеспечивают возможность экспериментировать с красками, тканями, кроем. Это позволяет постоянно создавать что-то новое, представляя результат своих поисков в ежегодных коллекциях.

В 2012 году появляется еще одна линия более дорогой и эксклюзивной одежды — Pavel Yerokin. Обе линии объединяет фирменный стиль: сочетание дерзкой оригинальности и комфорта, практичности и новизны. Неповторимый образ позволяет создать не только оригинальный крой и дизайн моделей, но и использование авторских принтов.

Высокое качество изделий гарантирует использование европейских тканей, 100% гусиного пуха из России и контроль над всей производственной цепочкой: от зарождения образа до продажи уже готового изделия в собственном магазине. В своих коллекциях дизайнер стремится создать целостный образ, поэтому данный бренд включает в себя не только одежду, но и аксессуары: сумки, ремни и т.п.

Собственно бренд Doctor E включает в себя одежду для женщин и мужчин в широком ассортименте. Для женщин предлагаются юбки, брюки, платья, сарафаны, шорты, жилеты и жакеты, трикотаж и джинсовая мода, туники и блузы. В качестве аксессуаров для женщин предлагаются сумки и головные уборы.

Обе линии для мужчин также включают джинсы, шорты, брюки, рубашки, трикотаж, пиджаки и жилеты, трикотажные шапки.
Как видим, ассортимент бренда позволяет и мужчинам, и женщинам сформировать гардероб полностью из вещей бренда, тем более, что под этой маркой выходит и верхняя одежда для межсезонья и для зимы: ветровки, куртки, пальто, пуховики.

Это позволит при желании создать свой собственный уникальный образ, обеспечивая комфорт, практичность и неповторимость стиля ее владельца.

Выставка WORKSHOP ТУРБИЗНЕС — Travel Russian News

ПРИГЛАШАЕМ посетить WORKSHOP «Турбизнес» ВЕСНА 2020

Примите участие в осенней серии региональных workshop «Турбизнес» — самых крупных, популярных и успешных профессиональных мероприятиях в регионах России и странах СНГ.

Региональные workshop — это профессиональные рабочие встречи между туроператорами и турагентствами, проводимые накануне летнего и зимнего сезонов в городах России и стран СНГ.  Это удачный способ налаживания партнерских отношений и развития агентской сети. Посещение workshop «Турбизнес»  – залог развития вашего бизнеса! Мероприятия отличают компактность по времени проведения и высокая посещаемость деловых встреч.


09.30 – 10.00 – регистрация посетителей

10.00 – 13.00 – презентации и МАСТЕР-КЛАССЫ  компаний

12.00 – 14.00 – назначенные встречи, workshop для специалистов (свободное общение)

В программе мероприятия пройдут кофе-брейк (или бизнес-завтрак для директоров компаний) и лотерея с призами от туроператоров.


•          Новинки и тренды сезона 2020;

•          Увлекательные морские и речные круизы;

•          Экскурсионные туры по Европе;

•          Экзотика: страны Юго-Восточной Азии и острова Индийского океана;

•          Чехия, Испания, Франция, Италия и не только! Турция, Таиланд;

•          Испания и Португалия — новинки и авторские туры от ВАНД;

•          Яркие экскурсионные туры с ТурТрансВояж;

•          Яркие маршруты для отдыха 2020: Испания только авторская, Финляндия не туристическая, Япония отдых в стиле «Дзен».

СПИСОК УЧАСТНИКОВ: http://www.tb-workshop.ru/ru/for-participants/participants-list/

ОБЯЗАТЕЛЬНАЯ РЕГИСТРАЦИЯ: http://www.tb-workshop.ru/ru/for-visitors/319/

НАЗНАЧЕНИЕ ВСТРЕЧИ С КОМПАНИЕЙ-УЧАСТНИКОМ: http://www.tb-workshop.ru/ru/login/?t=2


Медиахолдинг «Турбизнес»
Отдел workshop
Телефон: (495) 723-72-72
E-mail: [email protected]

Подведены итоги 35-го сезона Недели моды в Москве


4 апр. 2016 г.

Организаторы московской Недели моды опубликовали официальный пост-релиз 35-го сезона, прошедшего с 22 по 27 марта в Гостином дворе.

Амбассадором Недели моды в Москве в этом сезоне стала петербургская модель Ника Коул, которая регулярно принимает участие в мировых неделях моды и участвовала в показах Gucci, Prada, Dries Van Noten, Dior, Valentino, Maison Martin Margiela, Viсtoria Beckham и многих других.

По традиции первым шоу, открывающим Неделю моды в Москве, стал показ Валентина Юдашкина. Уже презентованная на Неделе моды в Париже коллекция была представлена в Москве. Основной темой стали сибирские богатства и русская зима. Сюрпризом для участников и всех поклонников моды стало дефиле Дома моды Пьера Кардена.

За шесть дней на подиумах Ильинский и Хрустальный свои коллекции представили такие известные имена российской моды, как Виктория Андреянова, Сергей Сысоев, Елена Теплицкая, Лиза Романюк, Галина Васильева, Елена Шипилова. Гости Недели с нетерпением ждали звездных и ярких показов от Ильи Шияна, Эрики Зайонц, Элеоноры Амосовой, а также показов зарубежных дизайнеров, испанской марки Palomo Spain, французского бренда La Redoute и китайского бренда Grace Chen. Гости Недели могли увидеть и образы легендарного мультфильма «Ледниковый период» в коллекции Sergey Sysoev для «Ледниковый период. Столкновение неизбежно».

В завершение Недели моды в Москве у светской столичной публики была возможность посетить показ дебютантки прошлого сезона — Наталии Гарт, которая представила публике коллекцию haute couture.

В рамках Недели моды в Москве продемонстрировали свои коллекции молодые российские дизайнеры. Яркие fashion-шоу создали представители молодежного движения – Даниил Анциферов, Елена Пискулина, бренд Math, So Number One, Denis Shevchenko и многие другие. Впервые на московском подиуме была представлена кутюрная коллекция от молодого дизайнера Аси Жуковой, декорированная элементами из янтаря. А также несколько перспективных молодых дизайнеров: NadiaSlavina, AllaCouture, AnnaRyapasova, KammilaPurshie, Aset, Humariff.

В пространстве шоу-румов, созданном при поддержке партнера Недели шоу-рума российских дизайнеров «Капсула» в Смоленском Пассаже и компании Royal l DressForms, демонстрировались трендовые новинки одежды. Также на площадке были представлены стенды лидирующих брендов, отвечающих за самый актуальный макияж и стиль причесоккоторые помогли гостям Недели по-настоящему приятно провести время.

Создавала образы для показов российских дизайнеров от Max Factor команда профессионалов под руководством национального визажиста Андрея Арбузова.

Официальным beauty-партнером и стилистом Недели моды в Москве выступил бренд Estel, который представила самые актуальные тренды осенне-зимнего сезона.

В этом сезоне важнейшей миссией Недели моды в Москве по-прежнему остается масштабная социальная программа, включившая показы финалистов конкурсов молодых дизайнеров «Точка Ru» и «Русский силуэт», а также благотворительный показ «Поможем подготовиться выпускникам к школьному балу». Премьеры ждали гостей и в конкурсной программе – на подиуме Недели состоялся финал первого всероссийского конкурса спортивной одежды Forward’s Sport Design. Также знаковым социальным событием стал показ НП «Открытый мир», в котором модели с ограниченными возможностями вышли на подиум со своими детьми, доказывая, что физические ограничения не являются препятствием в успешном развитии личности, реализации в разных областях, а самое главное – в личной жизни.

В рамках деловой программы Недели моды в Москве прошли лекции от компании Fashion Consulting Group и Центра «Менеджмент и коммуникации в индустрии моды» НИУ ВШЭ, которые были полезны начинающим и опытным дизайнерам для полного обзора инструментов продвижения собственного бизнеса.

Участники показов Недели моды в Москве: Валентин Юдашкин, Дом Моды Пьера Кардена, Александр Арутюнов, Елена Шипилова, Надя Славина, Виктория Андреянова, Галина Васильева, Лиза Романюк, Даниил Анциферов, Конкурс молодых дизайнеров «.RU», Вера Домокош, Math, AllaCouture, Sonumberone, DoubleDress, B&D,Институт Бизнеса и Дизайна, Анастасия Кучугова, Ася Жукова, Камилла Пурши, Анна Ряпасова, Открытый мир, Русский Силуэт, LaRedouteByPlusSizeMagazine (France), Светлана Евстигнеева, Китай, PalomoSpain (Madrid), Ася Соловьева, Елена Пискулина, Эрика Зайонц, Элеонора Амосова, Балнур Асанова (KZ), Humariff, Елена Теплицкая, Сергей Сысоев, MichalNegrin (Израиль), Irynvigre (London), Денис Шевченко, Павел Ерохин, Сабина Горелик, Aset, Илья Шиян, Мария Шошева, Наталия Гарт.

Напомним, «Неделя моды в Москве. Сделано в России» проводится Ассоциацией Высокой моды и Прет-а-порте при поддержке Минпромторга России, Правительства Москвы и Торгово-промышленной Палаты России.


V International Elbrus Race – 2009: краткие итоги

Проводимые при поддержке администрации Кабардино-Балкарской республики, соревнования Elbrus Race широко освещались в местных и общероссийских СМИ. Забег вызвал большой интерес спортивной общественности в России и за ее пределами и увлёк даже далёких от спорта людей. 11 сентября все жители России увидели сюжет о International Elbrus Race в новостном блоке на 1 канале центрального телевидения.Соревнования проходили в двух основных категориях — «классика» и «эктрим». Классическая: трасса начиналась на высоте 3700 м и заканчивалась на Западной вершине горы Эльбрус на высоте 5642 м. Участникам «экстрима» предстояло преодолеть маршрут до вершины от поляны Азау с перепадом высот свыше 3 км и протяженностью около 12 км.Победителем среди «экстремалов» стал прошлогодний лидер в «классике», 28-летний Сергей Фурсов из Невинномысска – его результат 4 часа 19 минут. Второе место завоевал альпинист из Тольятти Андрей Мариев, уложившийся в 4 часа 30 минут и улучшивший собственный прошлогодний результат на 1 час 18 минут (!). Александр Сидоренков из Смоленска, достигший вершины за 4 часа 34 минуты, получил почётное третье место.В классическом забеге первые строки протокола заняли новые, никому не известные имена молодых спортсменов. Лучшее время у мужчин — 2 часа 36 минут – показал Валентин Вергилюш из Ростова-на –Дону. Вторым стал Антон Прощенко из Омска, добежавший до вершины за 2 часа 43 минуты. Москвич Михаил Климов, в упорной борьбе завоевавший бронзу, сумел подняться на Эльбрус за 2 часа 45 минут.Из трёх девушек — участниц забега — одна не уложилась в контрольное время на седловине и вынуждена была повернуть вниз. Победительницей стала 19-летняя Мария Хитрикова из Днепропетровска, поднявшаяся на Эльбрус за 3 часа 48 минут (!) и обогнавшая многих мужчин. 26-летней Наталье Куракиной из Перми (4 часа 42 минуты) досталось серебро. После накаленных, насыщенных соревновательным духом дней, проведенных на Эльбрусе, спортсмены и судьи чувствовали себя единой командой, и расставаться было нелегко. Казалось, даже перемены в природе были созвучны настроению людей. 9 сентября в день забега было ясное солнечное утро, но как только спортсмены после финиша стали спускаться на Бочки, небо затянули облака, и вершина Эльбруса утонула в тумане. Уже на следующий день погода из летней превратилась в осеннюю.Под моросящим дождиком главный судья соревнований Владимир Шопин перед церемонией награждения подписывал сертификаты победителей и участников забега. Пришлось прикрыть от дождя разложенные наготове призы, на которые с интересом посматривали собравшиеся спортсмены. К счастью, вскоре вновь показалось солнце и осветило церемонию награждения. Дождавшись приезда съёмочной группы телеканала «Вести» и представителя Министерства спорта и туризма КБР, торжественное собрание открыл организатор соревнований Николай Шустров – он подвел итоги, поздравил спортсменов, поблагодарив соратников, спонсоров и судейскую команду. Махти Отаров, начальник отдела туризма Министерства спорта и туризма Кабардино-Балкарской Республики, преподнес мужчинам-победителям красивые кинжалы, а девушкам – работы местных художников. Старейшина советского альпинизма Валентин Божуков вручил призерам книги о гималайской экспедиции Ерохина. Обладатели первых мест во всех номинациях получили денежные призы от Мемориального фонда Анатолия Букреева.И конечно, ни один из призеров не остался без призов от компании БАСК, Генерального спонсора International Elbrus Race. Маша Хитрикова, лучшая среди женщин, порадовалась тёплой пуховке Эрцог — она пригодится ей в будущих восхождениях на восьмитысячники. Андрею Мариеву за второе место в «экстриме» достались кошки Simond. Другие победители также получили тёплые пуховки BASK, штормовые вещи BASK из мембранной ткани, а еще лавинные зонды и снежные лопаты KONG, футболки и носочки Boreal. Молодой корреспондент «Вестей» тоже увлекся альпинистской темой: одолжив у одного из спортсменов треккинговые палки и стартовый номер, он отправился вместе с оператором на ближайший склон, чтобы немедленно приступить к тренировкам. Вечером того же дня на товарищеском ужине в ресторанчике Абиль Кола немало бокалов было поднято и за устроителей, и за участников соревнований — за команды из разных городов и за каждого призера в отдельности. Спортсмены благодарили организаторов соревнований за заботу и дружескую поддержку. Шашлык, хичины, вино, балкарские танцы и радушный прием понравились и нашим зарубежным гостям. Коли Тибалди Люка (5 место в классике), впервые посетивший Россию для участия в Elbrus Race, сказал, что увезет домой, в Италию, в своем сердце всех русских друзей, которых он встретил на Эльбрусе, и что он абсолютно счастлив.Сергей Куракин из Перми, в этом году исполняющий обязанности доктора, приехал на Эльбрус с супругой, сыном и дочерью. «Как отец, я горд за свою Наталью (у нее второй результат среди женщин), а как врач – доволен, что все вы живы и здоровы», — произнес глава спортивного семейства.Павел Сушко из Самары, второй год участвующий в забеге (в этот раз – уже в категории экстрим), пожелал соревнованиям и в дальнейшем сочетать в себе сплав задора и энергии молодежи с опытом и мудростью ветеранов. Валентин Божуков напомнил о достижениях легендарных восходителей Владимира Балыбердина, Анатолия Букреева, Валерия Хрищатого. Присутствующий тут же заслуженный мастер спорта, гималаец Владимир Шопин поддержал тему и пожелал новых успехов нынешним молодым спорстменам.Несмотря на жёсткую борьбу и настоящий накал страстей, рекорд Дениса Урубко 2006 года — 3 часа 55 минут от Азау до Западной вершины, по мнению лидера забега -2009 Сергей Фурсова пока остается недосягаемой высотой.А Анатолий Букреев пробежал бы «классику» всего за 2 часа 10 минут (так пересчитал его результат от Приюта 11 до Восточной вершины, с учётом современной трассы, Александр Сидоренков, участник балыбердинского забега 1990 года и нынешний обладатель 3-го места в «экстриме»).Это значит, что и тем, кто упорно тренируется, чтобы улучшить собственный результат, и новичкам, впервые в этом году попробовавшим свои силы на Эльбрусе, есть, куда расти, куда бежать. До нового забега International Elbrus Race-2010! До новых встреч на Эльбрусе!


Высокотехнологичный бухгалтер

Совет директоров Росбанка назначил заместителем председателя правления банка ОЛЬГУ РЯБОВУ, кандидатура которой прошла согласование в ЦБ. Ранее она занимала пост главного бухгалтера, а теперь будет курировать вопросы информационных технологий, операционно-кассового обслуживания и оформления операций. Ольга Рябова пришла в Росбанк в сентябре 1998 года из Онэксимбанка, где работала заместителем главного бухгалтера. «Онэксим» не смог пережить кризис, и его правопреемником стал Росбанк.


Не дожидаясь увольнения

Руководитель Федерального агентства морского и речного транспорта (Росморречфлот) ВЯЧЕСЛАВ РУКША написал заявление об увольнении по собственному желанию. Чтобы освободить его от занимаемой должности, требуется согласие премьера Михаила Фрадкова. Наблюдатели уверены, что Вячеслав Рукша решил уволиться сам, не дожидаясь указаний «сверху». Возможной причиной отставки называют желание чиновников урегулировать отношение с «Российскими железными дорогами» (РЖД) и поставить во главе Росморречфлота человека, более лояльно настроенного по отношению к руководству РЖД.



Альфа-банк. Виктор Крючков занял пост первого вице-президента — регионального директора по корпоративному бизнесу в Южном федеральном округе.

Петро-аэро-банк. Должность вице-президента получил начальник управления планирования и отчетов Иван Бибинов.

«Росхлебопродукт». Елена Василевская стала генеральным директором. Она сменила на этом посту Григория Кошеля, который теперь является исполнительным директором.

«Росно-МС». Генеральным директором назначена исполняющая обязанности директора центра медицинского страхования компании «Росно» Галина Таланова.

«Регион Девелопмент». Павел Зюбин освободил пост генерального директора.

«Стройнефть». Генеральным директором центрального управления проектами стал Фарит Хайдаров. Прежде он занимал пост гендиректора компании «Северо-Западные магистральные нефтепроводы».

Комбинат «Магнезит». Генеральным директором назначен Игорь Аникиевич, сменивший на этом посту Анатолия Слободина.

«Континенталь Менеджмент». Андрей Волошин приступил к исполнению обязанностей генерального директора. Ранее он был замгендиректора по производству целлюлозно-бумажного комбината «Волга».

«Татнефть-регион». Заместитель генерального директора компании «Татнефть» по внешнеэкономической деятельности Хамит Хавеев назначен директором недавно созданной управляющей компании.

Самарский резервуарный завод. Председателем правления назначен двоюродный брат Президента РФ Игорь Путин.

«Русал». Евгений Соловьев получил должность заместителя генерального директора по защите ресурсов. В его компетенцию будет входить прогнозирование и оценка возможных рисков компании и совершенствование системы безопасности. Ранее Евгений Соловьев занимал пост замминистра внутренних дел РФ.

«Квант». Коммерческим директором производственного объединения назначен заместитель гендиректора «Стром Телекома» Берислав Чупич. Заместитель гендиректора «Медиатела» Артем Ерохин стал заместителем гендиректора по производству.

«МитЛэнд». Должность директора по логистике получил Алексей Ларионов.

«Лукойл». Первым вице-президентом стал Владимир Некрасов, пост советника президента занял Дмитрий Тарасов. Вице-президентами назначены Андрей Кузяев и Алексей Смирнов. Николай Инюшин возглавил компанию «Лукойл-Западная Сибирь».

ДЛА Пайпер. Управляющим партнером назначена Ольга Литвинова, а Руслан Васютин занял пост партнера петербургского офиса.

AGA Management. Артем Мовсесян назначен партнером российского офиса кипрской компании. Он будет отвечать за направление консультаций в области маркетинга ибрэндинга.

«Голден Телеком». Управляющим назначен Жан-Пьер Вандромм.

«Нефтеполис». Агентство «Центральное» возглавил Максим Давиденко.

«Комплексные энергетические системы». Должность финансового директора получил Игорь Ищенко, ранее являвшийся заместителем председателя правления Российских коммунальных систем.

«Комус». Должность директора департамента бизнес-технологий занял Илья Лоевский. В его обязанности войдет создание стандартизированной системы бизнес-технологий и совершенствование информационного обеспечения.

АРС. На созданную должность директора по сервису в России и СНГ назначен Самсон Беляев.

Avaya. Александр Красовский теперь является директором по продажам в СНГ. До этого он руководил группой по реализации СRМ-решений в странах Восточной Европы и СНГ.

«Бекар». Евгений Якушин получил должность директора по эксплуатации.



Федеральное агентство по строительству и жилищно-коммунальному хозяйству (Росстрой) возглавил Сергей Круглик, а бывший глава Росстроя Владимир Аверченко стал заместителем министра регионального развития.

Федеральная миграционная служба. Должность руководителя получил Константин Ромодановский.

Федеральная служба по финансовым рынкам. Руководителем регионального отделения в Приволжском федеральном округе назначен Олег Чупалов.

Федеральная налоговая служба. Сергей Баранов приступил к исполнению обязанностей директора межрегиональной инспекции по Уральскому федеральному округу.

Гр белая гвардия. Белая гвардия

Зоя закончила факультет журналистики МГУ. Тексты ее песен глубоки и поэтичны. У неё нежный и красивый … Читать всё

Годом рождения группы можно считать 1993 год, когда Зоя Ященко записала первый сольный альбом с одноимённым названием «Белая гвардия». Тогда же состоялись первые сольные концерты в Москве в концертных залах Олимпийской деревни, ДК МЭИ, ДК «Меридиан», в Политехническом музее и Центральном Доме Художника.

Зоя закончила факультет журналистики МГУ. Тексты ее песен глубоки и поэтичны. У неё нежный и красивый голос. Её мелодии запоминаются почти сразу, с первого прослушивания. Соединение голоса, текстов и музыки создают слишком нетрадиционный продукт, чтобы дать точное определение стиля. Сами музыканты группы говорят, что играют в стиле Сенти-Ментальный рок (sentimental rock).
Творчество Зои Ященко и «Белой Гвардии» очень литературно и драматургично, и, кажется, многие строки нашёптаны героями Кортасара, Ремарка, Бёлля, Лермонтова, с которыми ребята вместе пьют кофе в кофейнях, слоняются по ночным улицам Питера и Парижа. Их песни особенно близки студенческим душам, путешественникам, одиночкам, юным философам, тем, кто летает во сне и смотрит закаты на крышах высоток. Простая и вместе с тем необыкновенно изящная и тонкая музыка «Белой Гвардии» редко кого оставляет равнодушным. Потому что главное качество такой музыки — проникновенность. Это песни, способные затронуть самые тонкие струны души, они заставляют думать, чувствовать, переживать, плакать и смеяться, видеть красоту больших и маленьких вещей.

Первый раз «Белая Гвардия» появилась на экране ТВ в программе «Антропология» у Дмитрия Диброва, который случайно услышал Зоину песню по радио «Эхо Москвы» в салоне своей машины. После этого телеэфира группу пригласили на гастроли в Германию и Францию.
Как-то Зоины песни послушали создатели телесериала «Салон красоты», и предложили ей спеть в эпизоде песню «Одуванчик». А ещё одну Зоину композицию в первой серии фильма спела актриса Ольга Кабо.

Четыре текста «Белой Гвардии» цитирует в своих «Дозорах» популярный русский фантаст Сергей Лукьяненко, которому однажды кто-то из друзей посоветовал послушать песни группы, прислав ссылку на «белогвардейский» сайт.

В июле 2005 года «Песня рядового» из альбома «Кукла в кармане» попадает в программу «Худсовет» на «Нашем радио». По итогам месяца песня побеждает с большим отрывом от конкурентов и попадает в эфир «Нашего радио».

На этот момент уже записано 10 авторских альбомов. Сегодня «Белая Гвардия» — это гитарист Дмитрий Баулин, саунд-продюссер группы, автор аранжировок и музыки новых песен. Это флейтист-виртуоз Павел Ерохин, который в некоторых композициях не менее виртуозно играет на саксофоне. Не так давно в группе появился «свой» скрипач Павел Фильченко (до него на скрипке в «Белой Гвардии»» играли сессионные музыканты). Это перкуссионист Алексей Баулин и бас-гитарист Константин Реутов. И, конечно же, Зоя, которая поёт, иногда играет на акустической гитаре или на непальских караталах.

В 2005 году ребята записывают один за другим девятый и десятый альбомы «Кукла в кармане» и «Питер», и с декабря 2006 года «белогвардейская» песня «Питер» регулярно звучит на волнах радио «Русские песни».

2006 год. Выходит в свет Зоина книга «25 песен и 5 рассказов» и документальный фильм «Я буду лететь» о творчестве группы.

2008 год. На DVD выходит сборник видеоклипов группы. Все клипы сняты на непрофессиональную камеру Зоей и Димой.

В апреле 2009 года группа вновь гастролирует по Германии и Франции. В этом же 2009 году выходит сразу два альбома группы: в мае — альбом «Заводной сверчок», и в ноябре — альбом «Ключ из пепла».

В 2011 году выходит альбом «Сказки Метерлинка» с 12 песнями.

Официальный web-сайт группы.


Происхождение названия

Название группы напрямую не связано ни с Белым движением , ни с одноимённым романом Булгакова . Вплоть до своего первого выступления в 1993 году на фестивале им. В. Грушина , коллектив Зои Ященко не имел названия. Группа взяла его из первых строк своей первой песни:

Белая гвардия, белый снег,
Белая музыка революций,
Белая женщина, нервный смех,
Белого платья слегка коснуться…

Имя «Белая гвардия» закрепилось моментально, и менять его уже не было смысла. Позднее, отвечая на вопрос, откуда взялось такое название, Зоя придумала несколько версий ответа:

  1. «Белая гвардия» — это гвардия, которая служит Белой Богине (так называют Музу в древнегреческой мифологии).
  2. Ключевое слово в названии — «белая». Белый цвет символизирует чистый лист, на котором можно изобразить то, что захочешь.
  3. «Белая гвардия» — сокращённо «БГ», что значит «Бог », имя, данное Богом.

Творческий путь

Первоначальный состав группы был следующим: Зоя Ященко , Олег Заливако и Юрий Сошин. Первый альбом — «Белая гвардия» — был записан в домашних условиях, но, несмотря на качество записи, многие песни этого альбома стали хрестоматийными хитами (впоследствии песни с этого альбома были записаны заново в студийных условиях; переизданный вариант получил название «Когда ты вернёшься…»). В 1996 году состоялись первые сольные концерты группы в концертных залах Олимпийской деревни, ДК , ДК «Меридиан», в Политехническом музее и Центральном доме художника .

С 1999 года окончательно утверждается современный инструментальный состав группы (две гитары, бас, флейта, скрипка, перкуссия) не без помощи саунд-продюсера группы Дмитрия Баулина. В это же время группа впервые появляется на телевидении, в программе Дмитрия Диброва «Антропология ». «Белую Гвардию» приглашают на гастроли в Германию и Францию.

В 2006 году вышли в свет документальный фильм о творчестве группы «Я буду лететь» и книга Зои Ященко «25 песен и 5 рассказов». В 2008 году был выпущен сборник видеоклипов, снятых группой на непрофессиональную камеру.

Современный состав


Также в конце 2009 года был выпущен дебютный сольный альбом Дмитрия Баулина.

Напишите отзыв о статье «Белая гвардия (группа)»



  • ;
  • на сайте Kroogi ;
  • .

Отрывок, характеризующий Белая гвардия (группа)

Наташа подняла голову, и в губы поцеловав свою подругу, прижала к ней свое мокрое лицо.
– Я не могу сказать, я не знаю. Никто не виноват, – говорила Наташа, – я виновата. Но всё это больно ужасно. Ах, что он не едет!…
Она с красными глазами вышла к обеду. Марья Дмитриевна, знавшая о том, как князь принял Ростовых, сделала вид, что она не замечает расстроенного лица Наташи и твердо и громко шутила за столом с графом и другими гостями.

В этот вечер Ростовы поехали в оперу, на которую Марья Дмитриевна достала билет.
Наташе не хотелось ехать, но нельзя было отказаться от ласковости Марьи Дмитриевны, исключительно для нее предназначенной. Когда она, одетая, вышла в залу, дожидаясь отца и поглядевшись в большое зеркало, увидала, что она хороша, очень хороша, ей еще более стало грустно; но грустно сладостно и любовно.
«Боже мой, ежели бы он был тут; тогда бы я не так как прежде, с какой то глупой робостью перед чем то, а по новому, просто, обняла бы его, прижалась бы к нему, заставила бы его смотреть на меня теми искательными, любопытными глазами, которыми он так часто смотрел на меня и потом заставила бы его смеяться, как он смеялся тогда, и глаза его – как я вижу эти глаза! думала Наташа. – И что мне за дело до его отца и сестры: я люблю его одного, его, его, с этим лицом и глазами, с его улыбкой, мужской и вместе детской… Нет, лучше не думать о нем, не думать, забыть, совсем забыть на это время. Я не вынесу этого ожидания, я сейчас зарыдаю», – и она отошла от зеркала, делая над собой усилия, чтоб не заплакать. – «И как может Соня так ровно, так спокойно любить Николиньку, и ждать так долго и терпеливо»! подумала она, глядя на входившую, тоже одетую, с веером в руках Соню.
«Нет, она совсем другая. Я не могу»!
Наташа чувствовала себя в эту минуту такой размягченной и разнеженной, что ей мало было любить и знать, что она любима: ей нужно теперь, сейчас нужно было обнять любимого человека и говорить и слышать от него слова любви, которыми было полно ее сердце. Пока она ехала в карете, сидя рядом с отцом, и задумчиво глядела на мелькавшие в мерзлом окне огни фонарей, она чувствовала себя еще влюбленнее и грустнее и забыла с кем и куда она едет. Попав в вереницу карет, медленно визжа колесами по снегу карета Ростовых подъехала к театру. Поспешно выскочили Наташа и Соня, подбирая платья; вышел граф, поддерживаемый лакеями, и между входившими дамами и мужчинами и продающими афиши, все трое пошли в коридор бенуара. Из за притворенных дверей уже слышались звуки музыки.
– Nathalie, vos cheveux, [Натали, твои волосы,] – прошептала Соня. Капельдинер учтиво и поспешно проскользнул перед дамами и отворил дверь ложи. Музыка ярче стала слышна в дверь, блеснули освещенные ряды лож с обнаженными плечами и руками дам, и шумящий и блестящий мундирами партер. Дама, входившая в соседний бенуар, оглянула Наташу женским, завистливым взглядом. Занавесь еще не поднималась и играли увертюру. Наташа, оправляя платье, прошла вместе с Соней и села, оглядывая освещенные ряды противуположных лож. Давно не испытанное ею ощущение того, что сотни глаз смотрят на ее обнаженные руки и шею, вдруг и приятно и неприятно охватило ее, вызывая целый рой соответствующих этому ощущению воспоминаний, желаний и волнений.
Две замечательно хорошенькие девушки, Наташа и Соня, с графом Ильей Андреичем, которого давно не видно было в Москве, обратили на себя общее внимание. Кроме того все знали смутно про сговор Наташи с князем Андреем, знали, что с тех пор Ростовы жили в деревне, и с любопытством смотрели на невесту одного из лучших женихов России.
Наташа похорошела в деревне, как все ей говорили, а в этот вечер, благодаря своему взволнованному состоянию, была особенно хороша. Она поражала полнотой жизни и красоты, в соединении с равнодушием ко всему окружающему. Ее черные глаза смотрели на толпу, никого не отыскивая, а тонкая, обнаженная выше локтя рука, облокоченная на бархатную рампу, очевидно бессознательно, в такт увертюры, сжималась и разжималась, комкая афишу.
– Посмотри, вот Аленина – говорила Соня, – с матерью кажется!
– Батюшки! Михаил Кирилыч то еще потолстел, – говорил старый граф.
– Смотрите! Анна Михайловна наша в токе какой!
– Карагины, Жюли и Борис с ними. Сейчас видно жениха с невестой. – Друбецкой сделал предложение!
– Как же, нынче узнал, – сказал Шиншин, входивший в ложу Ростовых.
Наташа посмотрела по тому направлению, по которому смотрел отец, и увидала, Жюли, которая с жемчугами на толстой красной шее (Наташа знала, обсыпанной пудрой) сидела с счастливым видом, рядом с матерью.
Позади их с улыбкой, наклоненная ухом ко рту Жюли, виднелась гладко причесанная, красивая голова Бориса. Он исподлобья смотрел на Ростовых и улыбаясь говорил что то своей невесте.
«Они говорят про нас, про меня с ним!» подумала Наташа. «И он верно успокоивает ревность ко мне своей невесты: напрасно беспокоятся! Ежели бы они знали, как мне ни до кого из них нет дела».
Сзади сидела в зеленой токе, с преданным воле Божией и счастливым, праздничным лицом, Анна Михайловна. В ложе их стояла та атмосфера – жениха с невестой, которую так знала и любила Наташа. Она отвернулась и вдруг всё, что было унизительного в ее утреннем посещении, вспомнилось ей.
«Какое право он имеет не хотеть принять меня в свое родство? Ах лучше не думать об этом, не думать до его приезда!» сказала она себе и стала оглядывать знакомые и незнакомые лица в партере. Впереди партера, в самой середине, облокотившись спиной к рампе, стоял Долохов с огромной, кверху зачесанной копной курчавых волос, в персидском костюме. Он стоял на самом виду театра, зная, что он обращает на себя внимание всей залы, так же свободно, как будто он стоял в своей комнате. Около него столпившись стояла самая блестящая молодежь Москвы, и он видимо первенствовал между ними.
Граф Илья Андреич, смеясь, подтолкнул краснеющую Соню, указывая ей на прежнего обожателя.
– Узнала? – спросил он. – И откуда он взялся, – обратился граф к Шиншину, – ведь он пропадал куда то?

Ты — не раб!
Закрытый образовательный курс для детей элиты: «Истинное обустройство мира».

Материал из Википедии — свободной энциклопедии

Белая Гвардия
Ошибка Lua в Модуль:Wikidata на строке 170: attempt to index field «wikibase» (a nil value).

Ошибка Lua в Модуль:Wikidata на строке 170: attempt to index field «wikibase» (a nil value).


Ошибка Lua в Модуль:Wikidata на строке 170: attempt to index field «wikibase» (a nil value).


Ошибка Lua в Модуль:Wikidata на строке 170: attempt to index field «wikibase» (a nil value).

Другие названия

Ошибка Lua в Модуль:Wikidata на строке 170: attempt to index field «wikibase» (a nil value).

Языки песен

Ошибка Lua в Модуль:Wikidata на строке 170: attempt to index field «wikibase» (a nil value).


Ошибка Lua в Модуль:Wikidata на строке 170: attempt to index field «wikibase» (a nil value).


Происхождение названия

Название группы напрямую не связано ни с Белым движением , ни с одноимённым романом Булгакова . Вплоть до своего первого выступления в 1993 году на фестивале им. В. Грушина , коллектив Зои Ященко не имел названия. Группа взяла его из первых строк своей первой песни:

Белая гвардия, белый снег,
Белая музыка революций,
Белая женщина, нервный смех,
Белого платья слегка коснуться…

Имя «Белая гвардия» закрепилось моментально, и менять его уже не было смысла. Позднее, отвечая на вопрос, откуда взялось такое название, Зоя придумала несколько версий ответа:

  1. «Белая гвардия» — это гвардия, которая служит Белой Богине (так называют Музу в древнегреческой мифологии).
  2. Ключевое слово в названии — «белая». Белый цвет символизирует чистый лист, на котором можно изобразить то, что захочешь.
  3. «Белая гвардия» — сокращённо «БГ», что значит «Бог », имя, данное Богом.

Творческий путь

Первоначальный состав группы был следующим: Зоя Ященко , Олег Заливако и Юрий Сошин. Первый альбом — «Белая гвардия» — был записан в домашних условиях, но, несмотря на качество записи, многие песни этого альбома стали хрестоматийными хитами (впоследствии песни с этого альбома были записаны заново в студийных условиях; переизданный вариант получил название «Когда ты вернёшься…»). В 1996 году состоялись первые сольные концерты группы в концертных залах Олимпийской деревни, ДК , ДК «Меридиан», в Политехническом музее и Центральном доме художника .

Отрывок, характеризующий Белая гвардия (группа)

Пухлые Майины губки задёргались, и на щёчке появилась первая крупная слеза… Я знала, что если сейчас же это не остановить – слёз будет очень много… А в нашем теперешнем «общевзвинченном» состоянии допускать это было никак нельзя…
– Но вы ведь живы, правда же?! Поэтому, хотите этого или нет, но вам придётся жить. Думаю, что мама с папой были бы очень счастливы, если б узнали, что с вами всё хорошо. Они ведь очень любили вас… – как могла веселее, сказала я.
– Откуда ты это знаешь? – удивлённо уставилась на меня малышка.
– Ну, они свершили очень тяжёлый поступок, спасая вас. Поэтому, думаю, только очень сильно любя кого-то и дорожа этим, можно такое совершить…
– А куда мы теперь пойдём? Мы с вами пойдём?.. – вопросительно-умоляюще глядя на меня своими огромными серыми глазищами, спросила Майя.
– Вот Арно хотел бы вас забрать с собой. Что вы об этом думаете? Ему тоже не сладко… И ещё со многим придётся свыкнуться, чтобы выжить. Вот и поможете друг другу… Так, думаю, будет очень правильно.
Стелла наконец-таки пришла в себя, и сразу же «кинулась в атаку»:
– А как случилось, что этот монстр заполучил тебя, Арно? Ты хоть что-нибудь помнишь?..
– Нет… Я помню только свет. А потом очень яркий луг, залитый солнцем… Но это уже не была Земля – это было что-то чудесное и совершенно прозрачное… Такого на Земле не бывает. Но тут же всё исчезло, а «проснулся» я уже здесь и сейчас.
– А что если я попробую «посмотреть» через вас? – вдруг пришла мне в голову совершенно дикая мысль.
– Как – через меня? – удивился Арно.
– Ой, а ведь правильно! – тут же воскликнула Стелла. – Как я сама не подумала?!
– Ну, иногда, как видишь, и мне что-то в голову приходит… – рассмеялась я. – Не всегда же только тебе придумывать!
Я попробовала «включиться» в его мысли – ничего не происходило… Попробовала вместе с ним «вспомнить» тот момент, когда он «уходил»…
– Ой, ужас какой!!! – пискнула Стелла. – Смотри, это когда они захватили его!!!
У меня остановилось дыхание… Картинка, которую мы увидали, была и правда не из приятных! Это был момент, когда Арно только что умер, и его сущность начала подниматься по голубому каналу вверх. А прямо за ним… к тому же каналу, подкрались три совершенно кошмарных существа!.. Двое из них были наверняка нижнеастральные земные сущности, а вот третий явно казался каким-то другим, очень страшным и чужеродным, явно не земным… И все эти существа очень целеустремлённо гнались за человеком, видимо пытаясь его зачем-то заполучить… А он, бедняжка, даже не подозревая, что за ним так «мило» охотятся, парил в серебристо-голубой, светлой тишине, наслаждаясь необычно глубоким, неземным покоем, и, жадно впитывая в себя этот покой, отдыхал душой, забыв на мгновение дикую, разрушившую сердце земную боль, «благодаря» которой он и угодил сегодня в этот прозрачный, незнакомый мир…
В конце канала, уже у самого входа на «этаж», двое чудищ молниеносно юркнули следом за Арно в тот же канал и неожиданно слились в одно, а потом это «одно» быстренько втекло в основного, самого мерзкого, который наверняка был и самым сильным из них. И он напал… Вернее, стал вдруг совершенно плоским, «растёкся» почти до прозрачного дымка, и «окутав» собой ничего не подозревавшего Арно, полностью запеленал его сущность, лишая его бывшего «я» и вообще какого-либо «присутствия»… А после, жутко хохоча, тут же уволок уже захваченную сущность бедного Арно (только что зревшего красоту приближавшегося верхнего «этажа») прямиком в нижний астрал….
– Не понимаю… – прошептала Стелла. – Как же они его захватили, он ведь кажется таким сильным?.. А ну, давай посмотрим, что было ещё раньше?
Мы опять попробовали посмотреть через память нашего нового знакомого… И тут же поняли, почему он явился такой лёгкой мишенью для захвата…
По одежде и окружению это выглядело, как если бы происходило около ста лет назад. Он стоял по середине огромной комнаты, где на полу лежали, полностью нагими, два женских тела… Вернее, это были женщина и девочка, которой могло быть от силы пятнадцать лет. Оба тела были страшно избиты, и видимо, перед смертью зверски изнасилованы. На бедном Арно «не было лица»… Он стоял, как мертвец, не шевелясь, и возможно даже не понимая, где в тот момент находился, так как шок был слишком жестоким. Если мы правильно понимали – это были его жена и дочь, над которыми кто-то очень по-зверски надругался… Хотя, сказать «по-зверски» было бы неправильно, потому, что никакой зверь не сделает того, на что способен иногда человек…
Вдруг Арно закричал, как раненное животное, и повалился на землю, рядом со страшно изуродованным телом своей жены (?)… В нём, как во время шторма, дикими вихрями бушевали эмоции – злость сменяла безысходность, ярость застилала тоску, после перерастая в нечеловеческую боль, от которой не было никакого спасения… Он с криками катался по полу, не находя выхода своему горю… пока наконец, к нашему ужасу, полностью затих, больше не шевелясь…
Ну и естественно – открывши такой бурный эмоциональный «шквал», и с ним же умерев, он стал в тот момент идеальной «мишенью» для захвата любыми, даже самыми слабыми «чёрными» существами, не говоря уже о тех, которые позже так упорно гнались за ним, чтобы использовать его мощное энергетическое тело, как простой энергетический «костюм»… чтобы вершить после, с его помощью, свои ужасные, «чёрные» дела…
– Не хочу больше это смотреть… – шёпотом произнесла Стелла. – Вообще не хочу больше видеть ужас… Разве это по-людски? Ну, скажи мне!!! Разве правильно такое?! Мы же люди!!!
У Стеллы начиналась настоящая истерика, что было настолько неожиданным, что в первую секунду я совершенно растерялась, не находя, что сказать. Стелла была сильно возмущённой и даже чуточку злой, что, в данной ситуации, наверное, было совершенно приемлемо и объяснимо. Для других. Но это было настолько, опять же, на неё не похоже, что я только сейчас наконец-то поняла, насколько больно и глубоко всё это нескончаемое земное Зло ранило её доброе, ласковое сердечко, и насколько она, наверное, устала постоянно нести всю эту людскую грязь и жестокость на своих хрупких, ещё совсем детских, плечах…. Мне очень захотелось обнять этого милого, стойкого и такого грустного сейчас, человечка! Но я знала, что это ещё больше её расстроит. И поэтому, стараясь держаться спокойно, чтобы не затронуть ещё глубже её и так уже слишком «растрёпанных» чувств, постаралась, как могла, её успокоить.

Годом рождения группы можно считать 1993 год, когда Зоя Ященко записала первый сольный альбом с одноимённым названием «Белая гвардия». Тогда же состоялись первые сольные концерты в Москве в концертных залах Олимпийской деревни, ДК МЭИ, ДК «Меридиан», в Политехническом музее и Центральном Доме Художника.

Зоя закончила факультет журналистики МГУ. Тексты ее песен глубоки и поэтичны. У неё нежный и красивый голос. Её мелодии запоминаются почти сразу, с первого прослушивания. Соединение голоса, текстов и музыки создают слишком нетрадиционный продукт, чтобы дать точное определение стиля. Сами музыканты группы говорят, что играют в стиле Сенти-Ментальный рок (sentimental rock).
Творчество Зои Ященко и «Белой Гвардии» очень литературно и драматургично, и, кажется, многие строки нашёптаны героями Кортасара, Ремарка, Бёлля, Лермонтова, с которыми ребята вместе пьют кофе в кофейнях, слоняются по ночным улицам Питера и Парижа. Их песни особенно близки студенческим душам, путешественникам, одиночкам, юным философам, тем, кто летает во сне и смотрит закаты на крышах высоток. Простая и вместе с тем необыкновенно изящная и тонкая музыка «Белой Гвардии» редко кого оставляет равнодушным. Потому что главное качество такой музыки — проникновенность. Это песни, способные затронуть самые тонкие струны души, они заставляют думать, чувствовать, переживать, плакать и смеяться, видеть красоту больших и маленьких вещей.

Первый раз «Белая Гвардия» появилась на экране ТВ в программе «Антропология» у Дмитрия Диброва, который случайно услышал Зоину песню по радио «Эхо Москвы» в салоне своей машины. После этого телеэфира группу пригласили на гастроли в Германию и Францию.
Как-то Зоины песни послушали создатели телесериала «Салон красоты», и предложили ей спеть в эпизоде песню «Одуванчик». А ещё одну Зоину композицию в первой серии фильма спела актриса Ольга Кабо.

Четыре текста «Белой Гвардии» цитирует в своих «Дозорах» популярный русский фантаст Сергей Лукьяненко, которому однажды кто-то из друзей посоветовал послушать песни группы, прислав ссылку на «белогвардейский» сайт.

В июле 2005 года «Песня рядового» из альбома «Кукла в кармане» попадает в программу «Худсовет» на «Нашем радио». По итогам месяца песня побеждает с большим отрывом от конкурентов и попадает в эфир «Нашего радио».

На этот момент уже записано 10 авторских альбомов. Сегодня «Белая Гвардия» — это гитарист Дмитрий Баулин, саунд-продюссер группы, автор аранжировок и музыки новых песен. Это флейтист-виртуоз Павел Ерохин, который в некоторых композициях не менее виртуозно играет на саксофоне. Не так давно в группе появился «свой» скрипач Павел Фильченко (до него на скрипке в «Белой Гвардии»» играли сессионные музыканты). Это перкуссионист Алексей Баулин и бас-гитарист Константин Реутов. И, конечно же, Зоя, которая поёт, иногда играет на акустической гитаре или на непальских караталах.

В 2005 году ребята записывают один за другим девятый и десятый альбомы «Кукла в кармане» и «Питер», и с декабря 2006 года «белогвардейская» песня «Питер» регулярно звучит на волнах радио «Русские песни».

2006 год. Выходит в свет Зоина книга «25 песен и 5 рассказов» и документальный фильм «Я буду лететь» о творчестве группы.

2008 год. На DVD выходит сборник видеоклипов группы. Все клипы сняты на непрофессиональную камеру Зоей и Димой.

В апреле 2009 года группа вновь гастролирует по Германии и Франции. В этом же 2009 году выходит сразу два альбома группы: в мае — альбом «Заводной сверчок», и в ноябре — альбом «Ключ из пепла».

В 2011 году выходит альбом «Сказки Метерлинка» с 12 песнями.

Официальный web-сайт группы: www.bgvmusic.ru

Белая Гвардия — группа, представляющая собой инструментализированную поэзию, играющая в стиле «Сенти-Ментальный рок «. Этимология этого словосочетания следующая: ментальный — значит умственный, сентиментальный — чувственный. А РОК — понимать можно по-разному: или как направление в музыке, или как судьбу, предначертанное, неминуемое. Сенти-Ментальный рок — узкая тропинка между логикой и чувством, попытка объединить женское и мужское начало, инь и ян…

Творчество Белой Гвардии очень литературно и драматургично, и, кажется, многие строки нашептаны героями Кортасара, Ремарка, Бёлля, Лермонтова, с которыми ребята вместе пьют кофе в кофейнях, слоняются по ночным улицам Питера и Парижа. Их песни особенно близки студенческим душам, бродягам, одиночкам, юным философам, тем, кто летает во сне и смотрит закаты на крышах высоток…

Группа была основана в 1991 году и долгое время представляла собой авторский дуэт: основатель группы — бессменный лидер Белой Гвардии , автор стихов и музыки, и Олег Заливако — мужская часть идеологического ядра группы, так же автор собственных стихов и музыки.

В 1993 году Белая Гвардия выпускает свой первый альбом , а летом ребята едут на ежегодный фестиваль им. Валерия Грушина и, выступая там уже как трио (за соло-гитару сел Юрий Сошин ), становятся лауреатами. С этого момента, собственно, и начался большой тернистый творческий путь группы.

В 1994 году выходят один за другим альбомы и . В музыке появились звуки флейты, клавишных, бас-гитары, столь не характерных элементов для бардовской песни. Тем не менее, это придало стихам Зои Ященко нужные краски, изящество и своеобразие.

В 1999 году Зоя приглашает в группу гитариста и клавишника Дмитрия Баулина , который впоследствии становится саунд-продюссером Белой Гвардии. С ним она записывает альбом .

Затем Зоя с Димой набирают команду, состав которой оказывается наиболее подходящим для исполнения Зоиных песен — две гитары, бас, флейта, скрипка, перкуссия. При этом качественно преображается общий саунд группы.

2000 год. Выходит альбом . — сборник лучших песен в новом акустическом звучании. Группа принимает участие в программе «Антропология» на НТВ.

Конец 2001 года — начало 2002 года . Записываются сразу два альбома и . . Последний является «реинкарнацией» самого , который в первоначальном варианте представлял собой весьма традиционную шестиструнную романтику. Но ввиду изменений музыкальных пристрастий, а также студийных условий, Белая Гвардия решила сыграть и спеть старые песни по-новому. При этом хрестоматийное название первого альбома, который так и назывался , осталось нетронутым и вместе с альбомом было «сдано в архив». Новый старый альбом называется . . В альбом также включены некоторые старые песни, не вошедшие ни в один из альбомов.

На настоящий момент у Зои Ященко и «Белой Гвардии» 15 альбомов. и вышли почти в одно время, в 2005 году с промежутком в 5 месяцев. И, наверное, вполне могли бы стать одним двойным альбомом. Но не стали. Хотя они и были записаны в одном музыкальном ключе, все же сильно отличаются по тематике.

В 2009 году Белая Гвардия выпускает сразу два альбома и .

Зоя Ященко и Белая Гвардия регулярно выступает в Москве на таких площадках, как Центральный Дом Художника, Политехнический музей, бард-кафе «Гнездо глухаря» и др. Группа ездит на гастроли в города С-Петербург, Ижевск, Самару, Иваново, Пермь, Воронеж, Фурманов, Тверь, Новокузнецк и др.

Другие новости

Награждены победители конкурсов управленцев «Менеджер года — 2019»

https://static.news.ru/photo/b7240644-0e0c-11eb-8514-fa163e074e61_660.jpg Фото: mam-unex.ru

11 октября 2020 года в Историческом отеле «Советский» состоялась торжественная церемония награждения победителей XXIII Московского и Российского конкурсов управленцев «Менеджер года — 2019», которая прошла в деловой атмосфере нетворкинга и общения среди разных представителей управленческой элиты нашей страны.

Конкурс осуществляет одну из важнейших задач — способствует развитию и внедрению научных основ управления в практическую деятельность. Именно поэтому на протяжении всего времени он завоёвывает всё больший авторитет среди менеджеров.

За время, прошедшее с момента учреждения конкурса, существенно изменились внутриполитическая обстановка, экономические условия, в которых действуют наши управленцы.

К управленческим кадрам предъявляется спрос за результативность и эффективность, и подчас очень взыскательный. От современного управленца требуется не только верная постановка целей и задач, но и реализация их с учётом многих факторов, среди которых очень важным является требование открытости управленческой деятельности и необходимость постоянно сверять менеджмент с обществом и государством.

Но главные цели конкурса «Менеджер года» остаются прежними: выявление лучших управленцев, лучших менеджерских практик, лучших управленческих команд; создание для них новых коммуникационных возможностей для взаимодействия и совместной работы над проектами.

В активе победителей прошлых лет крупные экономические проекты, предприятия и организации, решающие самые разные задачи в хозяйственной и социальной жизни, успешное государственное и муниципальное управление, интересные кейсы в сфере, бизнеса, образования, НКО и благотворительности.

С. Н. Рябухин и Владимир Усановmam-unex.ru

Вручение наград Российского и Московского конкурсов «Менеджер года» провели С. Н. Рябухин — член экспертного совета (жюри) Российского конкурса управленцев «Менеджер года», член Президиума, академик Международной Академии менеджмента, первый заместитель председателя Комитета Совета Федерации Федерального Собрания Российской Федерации по бюджету и финансовым рынкам, доктор экономических наук, и М. П. Чочуа — член Экспертного совета (жюри) Московского городского конкурса управленцев «Менеджер года», член Наблюдательного совета конкурса управленцев «Менеджер года», вице-президент, академик Международной Академии менеджмента, президент Корпорации «Мосстройтранс», кандидат экономических наук, заслуженный работник транспорта РФ, неоднократный победитель конкурса «Менеджер года».

По результатам Московского городского конкурса управленцев «Менеджер года» жюри определило: 8 абсолютных победителей, 64 победителя в 16 отраслевых номинациях, а также 11 менеджеров из 2 организаций в номинации «Команда года».

Российский конкурс управленцев «Менеджер года» является завершающим этапом и проводится среди победителей региональных конкурсов. В ходе конкурсных испытаний производится всестороннее изучение вклада участников в развитие экономики регионов и страны в целом, производится сбор сведений о наиболее успешных предпринимательских и управленческих практиках, а жюри конкурса ранжирует успехи конкурсантов, вынося мотивированную оценку их достижениям.

По результатам Российского конкурса «Менеджер года — 2019» жюри определило: 11 абсолютных победителей, награждаемых статуэткой Екатерины II, впервые в истории России учредившей смотр передовых методов ведения хозяйства и лучших управленцев; за значительные достижения в области менеджмента в номинации «Стабильные результаты работы и эффективное управление» 6 управленцев награждены памятным призом «Копилка», изготовленным на основе подлинной автоматической копилки XIX века — прообраза первого банковского сейфа из коллекции Л. И. Лифлянда; в отраслевой номинации конкурса определено 43 победителя в 24 номинациях и 6 менеджеров из 1 организации в номинации «Команда года».

Состав победителей по итогам 2019 года отражает изменения, происходящие в экономике страны. Значительное число победителей представляют инфраструктуру, транспорт, культуру, и особенно социальную сферу.

Экспертный совет (жюри) Российского конкурса в качестве сопредседателей возглавили:

Сергей Юрьевич Глазьев — вице-президент Международной Академии менеджмента, член Коллегии (министр) по интеграции и макроэкономике Евразийской экономической комиссии (ЕЭК), академик Российской академии наук, доктор экономических наук, профессор.

Юрий Витальевич Росляк — вице-президент Международной Академии менеджмента, заместитель генерального директора по капитальному строительству Государственной корпорации по космической деятельности «Роскосмос», кандидат экономических наук, заслуженный строитель РФ.

Владимир Иванович Щербаков — член последнего советского правительства, основатель автомобильного производства в Калининграде, президент Международной Академии менеджмента, известный промышленник, экономист и общественный деятель.

Абсолютные победители Российского конкурса управленцев «Менеджер года — 2019»:

Батырев Максим Валерьевич
Руководитель Batyrev Consulting Group, г. Москва

Бормотов Сергей Андреевич
Руководитель архитектурного отдела ООО «Вента», г. Москва

Евсеев Анатолий Дмитриевич
Глава муниципального округа Рязанский в городе Москве, кандидат экономических наук

Ершов Алексей Станиславович
Генеральный директор АО «Дальсбыт», доктор экономических наук, г. Комсомольск-на-Амуре

Мавзолевский Дмитрий Владимирович
Директор по строительству в инжиниринговой компании «Смарт Инвест»

Манюшис Альгирдас Юозович
Ректор Московского международного университета, доктор экономических наук, профессор

Перемятов Александр Александрович

Салихов Мазит Хазипович
Начальник Государственного автономного учреждения «Управление государственной экспертизы и ценообразования Республики Татарстан по строительству и архитектуре» (ГАУ «УГЭЦ РТ»), действительный муниципальный советник 1-го класса, кандидат экономических наук, заслуженный строитель Республики Татарстан

Симоньян Маргарита Симоновна
Главный редактор Телеканала RT

Шарипзянова Гюзель Харрясовна
Проректор по учебной работе ФГБОУ ВО «Московский политехнический университет», кандидат технических наук, доцент

Янковская Ольга Николаевна
Руководитель Русской Школы Элегантности

Победители в номинациях:

Номинация «Стабильные результаты работы и эффективное управление»

Алекперов Мусейб Ильгам оглы
Учредитель, директор Автономной некоммерческой организации «Информационно-аналитический центр «МедиаНьюс», г. Москва

Костина Вероника Викторовна
Управляющий инвестиционным портфелем ООО «Управляющая компания АйПиТи Управление активами», г. Москва

Попов Олег Александрович
Директор ООО «Базстрой», почётный строитель города Москвы, г. Москва

Смуров Сергей Владимирович
Первый Вице-президент — Главный конструктор Межрегионального общественного учреждения «Институт инженерной физики», доктор технических наук, профессор, почётный работник науки и техники РФ, Московская область, г. Серпухов

Трубецкой Андрей Александрович
Глава Сургутского района Администрации Сургутского района Ханты-Мансийского автономного округа — Югры, действительный муниципальный советник 2-го класса

Федоров Андрей Леонтьевич
Глава Котельниковского городского поселения Котельниковского муниципального района Волгоградской области — Глава администрации Котельниковского городского поселения Котельниковского муниципального района Волгоградской области, действительный муниципальный советник 1-го класса

Аграрная сфера

Матвеева Анна Анатольевна Финансовый директор ООО «Агрофирма «Золотая Балка», г. Севастополь

Безопасные и качественные автомобильные дороги

Орешкин Александр Станиславович Руководитель Государственного бюджетного учреждения города Москвы «Автомобильные дороги»


Теркулова Рания Райфовна Главный врач Государственного автономного учреждения здравоохранения «Стоматологическая поликлиника № 1», Республика Татарстан, г. Набережные Челны

Инновации и научно-технические разработки

Ерохин Павел Васильевич
Начальник отдела аэродинамических исследований Публичного акционерного общества «Туполев», кандидат технических наук, г. Москва

Попов Алексей Геннадьевич
Начальник управления прочностных исследований и технической диагностики Межрегионального общественного учреждения «Институт инженерной физики», кандидат технических наук, профессор, почетный работник науки и техники РФ, Московская область, г. Серпухов


Купина Юлия Рафаиловна
Генеральный директор ООО «МЭТЭКС», г. Москва

Сидоров Александр Николаевич
Генеральный директор ООО «Газпром газораспределение Волгоград»

Солодков Дмитрий Евгеньевич
Начальник центральной диспетчерской службы ООО «Концессии водоснабжения», г. Волгоград

Текучев Андрей Васильевич
Директор Муниципального унитарного предприятия «Тепловые сети», Волгоградская область, г. Котельниково

Царегородцев Александр Витальевич
Директор ООО «Теплоцентраль», г. Щелково, Московская область

Команда года

Финансовый факультет Российского экономического университета имени Г.В. Плеханова

  • Азизи Екатерина Олеговна
    Начальник отделения финансового факультета
  • Афанасиади Козмас Георгиевич
    Начальник отделения
  • Захарова Джамиля Сафуатовна
    Начальник отделения
  • Корягина Инга Анатольевна
    Начальник Международного отделения Финансового факультета
  • Покаместов Дмитрий Александрович
    Начальник отделения финансового факультета
  • Шеметкова Ольга Леонидовна
    Декан финансового факультета


Аннинская Екатерина Львовна
Директор по внешним и внутренним коммуникациям Креативного коммуникационного агентства DPG Russia, г. Москва


Боков Сергей Евгеньевич
Директор ООО «Культурно-коммерческая фирма «Тонус», Московская область, г. Сергиев Посад

Рудницкий Георгий Михайлович
Генеральный директор Акционерного общества «Редакция газеты «Вечерняя Москва»

Стефанович Александр Борисович
Продюсер, режиссер-постановщик ФГУП киноконцерн «Мосфильм», заслуженный деятель искусств Российской Федерации

Фадеев Владимир Викторович Директор филиала ФГУП «Российская телевизионная и радиовещательная сеть» «Волгоградский Областной Радиотелевизионный Передающий Центр» «РТРС»

Международное сотрудничество

Каирбеков Бахыт Гафуович
Президент АО «Казахфильм» имени Ш. Айманова, Республика Казахстан

Э Янь (Ms. E YAN)
Начальник международного отдела Хэйлунцзянского телерадиовещания, Китайская Народная Республика

Муниципальное управление

Еремеев Валерий Васильевич
Глава Нижнесергинского муниципального района, Свердловская область, г. Нижние Серги

Маркова Юлия Витальевна
Заместитель главы Сургутского района Администрации Сургутского района Ханты-Мансийского автономного округа — Югры, действительный муниципальный советник 1 класса

Нигматуллин Максим Эдуардович
Заместитель главы Сургутского района Администрации Сургутского района Ханты-Мансийского автономного округа — Югры, действительный муниципальный советник 1 класса

Юдин Владислав Юрьевич
Глава городского округа Долгопрудный, Московская область, действительный муниципальный советник Московской области 1 класса


Карпеев Владимир Владимирович
Директор Государственного бюджетного профессионального образовательного учреждения Московской области «Мытищинский колледж»

Пищевая промышленность

Цветкова Елена Вячеславовна
Начальник управления по работе с персоналом АО «Мясокомбинат Клинский», Московская область

Производительность труда и поддержка занятости

Акуленко Ольга Михайловна
Начальник Управления информационных систем и технологий Государственного казенного учреждения города Москвы Центр занятости населения города Москвы


Курина Татьяна Николаевна
Директор по стратегическому развитию ООО «Завод Молмаш», г. Москва

Ригерт Виталий Александрович
Директор по производству Акционерного общества «КАУСТИК», г. Волгоград

Развитие человеческого капитала

Сидорок Иван Викторович
Директор Государственного бюджетного учреждения Московской области «Спортивная школа олимпийского резерва по игровым видам спорта», г. Щелково

Социальная защита населения

Кабанов Владимир Львович
Директор Государственного бюджетного учреждения Центр поддержки семьи и детства «Красносельский» Центрального административного округа города Москвы, доктор юридических наук, кандидат педагогических наук, профессор


Джамзаров Сулейман Камалудинович Руководитель управления строительного контроля ООО «КунцевоСтройИнвест», г. Москва

Какулия Ираклий Георгиевич
Вице-президент ООО «КОРПОРАЦИЯ МОССТРОЙТРАНС», г. Москва


Лобачева Екатерина Евгеньевна
Начальник Дирекции персонала ООО «Тамерлан», г. Волгоград

Халина Оксана Витальевна
Коммерческий директор торговых сетей Дом Фарфора и Williams et Oliver, г. Москва


Суслова Александра Николаевна
Главный бухгалтер ООО «Логистика для Вас», г. Москва

Управление мегаполисом

Муртазин Фархад Абдулахатович
Директор Государственного казенного учреждения «Развитие московского региона», кандидат юридических наук

Тиунова Лариса Ивановна
Заместитель префекта Центрального административного округа города Москвы

Управление структурным подразделением

Коваленко Ирина Петровна
Руководитель проекта «Профилактика здоровья женской груди» НМИЦ онкологии им. Н.Н. Блохина МЗ РФ, г. Москва

Кочоян Теймураз Мразович
Руководитель проекта «Дифференциальная и неотложная диагностика в онкологии» направленная на повышение квалификации профессорско-преподавательского состава НМИЦ онкологии им. Н.Н. Блохина МЗ РФ, г. Москва

Управленческий консалтинг

Лёвушкин Иван Александрович
Президент Автономной некоммерческой организации по содействию экономической активности предпринимателей «Корпорация Альфа», кандидат технических наук, г. Москва

Ложкин Сергей Александрович
Генеральный директор ООО «НФП Бизнес решения» (NFP), г. Москва


Кириллов Максим Владимирович
Исполнительный директор, директор административного департамента КБ «Ренессанс Кредит» ООО, г. Москва

Цифровая экономика

Карпицкий Олег Станиславович
Коммерческий директор ООО «Современные технологии мониторинга», г. Санкт-Петербург

Поповкин Михаил Владимирович
Директор проектов ООО «ТКО-Информ», г. Москва


Шкрабляк Николай Степанович
Генеральный директор ООО «Матрица», кандидат экономических наук, Московская область, г. Балашиха

Абсолютные победители Московского городского конкурса управленцев «Менеджер года — 2019»:

Барановский Александр Петрович
Директор Государственного бюджетного общеобразовательного учреждения города Москвы «Центр образования и спорта «Москва-98» Департамента спорта города Москвы

Зайнудинов Зайнудин Мусаевич
Главный врач Клиники Федерального государственного бюджетного учреждения науки «Федеральный исследовательский центр питания, биотехнологии и безопасности пищи» (Клиника ФГБУН «ФИЦ Питания и биотехнологии»), доктор медицинских наук

Манюшис Альгирдас Юозович
Ректор Московского международного университета, доктор экономических наук, профессор

Мерванян Саркис Размикович
Директор Государственного бюджетного учреждения культуры города Москвы «Культурный центр «Москвич»

Попов Олег Александрович
Директор ООО «Базстрой», почётный строитель города Москвы

Пчельников Геннадий Игнатьевич
Глава муниципального округа Котловка города Москвы, председатель Совета депутатов муниципального округа Котловка

Фролов Никита Игоревич
Директор Государственного бюджетного учреждения культуры города Москвы «Культурный центр «Яковлевское», директор Государственного бюджетного учреждения культуры города Москвы «Культурный центр «Киевский»

Шарипзянова Гюзель Харрясовна
Проректор по учебной работе ФГБОУ ВО «Московский политехнический университет», кандидат технических наук, доцент

Мероприятие широко освещается средствами массовой информации.

Генеральный информационный партнёр конкурса — федеральный новостной портал NEWS.ru.

Добавить наши новости в избранные источники

Население Гринвейла

Angove McLaren Vale Vineyards and Cellar Door — Изображение Angove McLaren Vale Vineyards and Cellar Door — Изображение Angove McLaren Vale Cellar Door

секса в Морфетт Вейл? Мы — один из крупнейших сайтов секса в Аделаиде. Вот несколько местных жителей, ищущих секса в Австралии, Морфетт Вейл. Найдите настоящую любовь в Free Dating Australia. Как ведущий сайт знакомств в Макларен-Вейл и Австралии в целом, Free dating Australia призвана обеспечить.

С июня по октябрь ищите китов на вершине утеса или просто любуйтесь видами на побережье.Поезжайте в близлежащую долину Инман с ее величественной дорогой, покрытой огромными камнями, чтобы увидеть Ледниковую скалу, обнаруженную в одном из крупнейших ледниковых обнажений в мире, которая привлекает геологов со всего мира.

Или же поезжайте по Аделаиде-роуд до горы Компас, чтобы попробовать вина и сезонные придорожные ягоды. Двигайтесь по Range Road на запад от Victor Harbour. Большую часть дня серых кенгуру можно увидеть на холмах за пляжем. Отправляйтесь в заповедник Дип-Крик с его захватывающими прибрежными пейзажами, богатой дикой природой, местом для кемпинга и прогулками по кустам.Близлежащий заповедник Талискер хорошо обозначен указателями и рассказывает о ранних поисках полезных ископаемых Корнуолла. С мыса Джервис автомобильные и пассажирские паромы отправляются каждый день на остров Кенгуру.

Бронирование на летнее время является обязательным. Город Кейп-Джервис предлагает хорошие лодки, причалы и пляжную рыбалку, а также широкий выбор жилья и топлива. Вид на океан из городка просто великолепен.

Проверьте условия бронирования

Покинув мыс, полюбуйтесь видами со смотровой площадки на Сапперс-роуд.Поездка в Рапид-Бей стоит потраченного времени. Вы находитесь в точке, где полковник Уильям Лайт впервые сошел на берег, чтобы основать колонию в Южной Австралии. Он записал это событие, вырезав свои инициалы и дату на валуне, который все еще находится на месте. Во Второй долине можно совершить еще одну поездку к побережью, где вас ждут впечатляющие утесы, отличная рыбалка на пристани и интересная геология. Этот район также является популярным местом для занятий дайвингом и сноркелингом.

Одинокие женщины Morphett Vale в Австралии, заинтересованные в Fuckbook Dating, Fbook Australia

К северу находится главный четырехзвездочный курорт штата, Paradise Wirrina Cove, предлагающий путешественникам широкий выбор стилей и стандартов проживания, роскошные удобства и широкий спектр мероприятий, в том числе прогулки по кустам, игра в гольф и причал для яхт.Кто мы размещаем Долгосрочное жилье для арендаторов с низким доходом, включая пожилых людей, беженцев, одиноких людей, семьи с одним родителем и людей с ограниченными возможностями.

Кто у нас проживает Жители Южной Австралии, получающие независимый доход. Для переселения заявителей, ранее выселенных Anglicare SA Housing Association Inc или имеющих в прошлом: нанесение ущерба собственности Anglicare SA Housing Association Inc, подрывное или антиобщественное поведение, вызывающее потенциальный риск для здоровья или безопасности, требуется одобрение Правления ассоциации. окружающих соседей.Кто мы размещаем Common Equity Housing оказывает помощь своим организациям-членам, выполняя от их имени различные административные и имущественные функции.

Мы стремимся обеспечить безопасность проживания для людей с низким доходом и дать нашим членам ощущение собственности на недвижимость, которую они арендуют. В свою очередь, все члены участвуют в работе Кооператива и имеют возможность развивать новые навыки и знакомиться с новыми людьми. Это было целью первоначальной группы, и мы до сих пор стараемся отбирать таких арендаторов, по возможности выбирая польских мигрантов.

Мы стремимся действовать в духе международных принципов сотрудничества и работать с организациями единомышленников, чтобы продвигать ценность общественного жилья. Кто мы живем Люди, подверженные риску бездомности, страдающие психическим заболеванием, коренные жители, переезжающие в столичную Аделаиду ​​для получения образования или работы, а также семьи, нуждающиеся в поддержке со стороны других служб по месту жительства и инвалидов.

Кто мы принимаем Обездоленные группы, такие как престарелые, инвалиды, студенты, коренные жители, беженцы, родители-одиночки и семьи, связанные с группами поддержки и агентствами и нуждающиеся в жилье.Кто мы размещаем Арендаторы должны соответствовать желаемому профилю арендатора конкретного жилища.


Профиль может включать: человека, который живет с ограниченными возможностями и получает высокий уровень личной поддержки и направлен Disability SA из списка ожидания поддерживаемого жилья, человек, который живет с ограниченными возможностями и который подходит для доступа особенности жилища обездоленное лицо с очень низким или низким доходом; лицо с низким или средним доходом, которое может внести положительный вклад в жизнь соседства с другими людьми по согласованию.

Кто мы размещаем Minda Incorporated — это независимый негосударственный благотворительный поставщик жилья, созданный в первую очередь для предоставления доступного жилья людям с ограниченными возможностями. Кто мы живем Обеспечиваем адекватное и доступное жилье для людей, находящихся в неблагоприятном социальном и экономическом положении.

  • мест датирования недалеко от Хайтона, Австралия.
  • Одинокий Morphett Vale Girls, заинтересованные в секс-свиданиях, F * ckbook Australia.

Кто мы предоставляем жилье Доступное жилье для людей с низким и средним доходом, которые испытывают трудности с получением жилья на частном рынке аренды. Где вы услышали о нас? Просто выберите 6 или 12 вин в нашем интернет-магазине и частоту, с которой вы хотели бы получать. Механизмы предупреждения предоставляют общую информацию для региона или области и не могут предоставить информацию для определенных мест. Ссылка на видеозапись встречи свингеров Tumblr Ballarat будет доступна как Adult bliss Bunbury по мере возможности после встречи.

Экстренное предупреждение. Выдается, когда лесной пожар онлайн-девушка, болтающая в Олбани, выходит из-под контроля при очень высоких или катастрофических погодных условиях. Мы отправим вам товар за две недели до запланированной отправки, чтобы у вас было достаточно времени для внесения изменений. Под неусыпным присмотром покойного Грега Тротта и его двоюродного брата Роджера винодельня была перестроена из остатков двух стен и нескольких резервуаров для брожения сланца.

Художественные мастерские Энциклопедия массажа Вуллонгонг в формате pdf доступна для массажистов города Кофс-Харбор и детей, включая корпоративные группы или специальные мероприятия.Пожары могут случиться внезапно и без предупреждения. Red dating Australia Morphett Vale Наша цель проста — открыться с новой энергией, энтузиазмом и страстью ко всем аспектам нашего бизнеса.

Клетки для кошек можно приобрести у коммерческих поставщиков. Желтый цвет «Наблюдай и действуй» — сообщения подтверждают необходимость того, чтобы люди знали о своей ситуации и обстоятельствах вокруг них, а также принимали меры для подготовки и защиты себя, своей семьи и соседей. Предоставляются такие дополнительные принадлежности, как масло, соль и перец, а также подставка для специй.

Завтрак включен. Бесплатный вай-фай. Да, в некоторой степени. Эта простая в использовании функция поиска позволяет найти все, что вы когда-либо хотели знать о винах, рейтингах вин, производителях и винтажах. BWW Competition получил более 5. Спасибо за доверие! Здесь вы можете увидеть винные моменты от пользователей дегустационной книги. C Pannell Wines. Добавить новый комментарий. М. В. Шираз, Пакстон. Неверная информация.

Если вы обнаружили неверную информацию, сообщите нам. Введите сообщение Зарегистрируйтесь сейчас, это быстро, легко и совершенно бесплатно.Никаких обязательств, только удовольствие. Базилиско Альянико дель Стервятник, Базилиско.

Доставка на дом / Доставка

В сообщениях Snapchat Том сказал ей, что она «неполноценная» и «такая же дисгеничная, как ты, чтобы служить нам». В субботу г-жа Сандерсон поделилась мрачными разговорами и агрессивными голосовыми сообщениями, которые она получила от Тома после того, как отклонила его предложение присоединиться к нему в его доме. Ты знаешь что? — Ты зря потратил мое время, — сказал он. Когда она крикнула ему о его агрессивном поведении, он затем удвоился и защищался.

Bondi Vet — CBC Media Center

Мне не нужно бороться, чтобы получить секс. Мне особенно не нужны ЧЕТЫРЕ, как ты, чтобы трахаться. Пост стал вирусным, тысячи женщин сплотились вокруг г-жи Сандерсон в знак поддержки. Позже г-жа Форд рассказала своим подписчикам, что она узнала, что Том был уволен со своего работодателя из-за его поведения.

Босс Тома сказал Daily Mail Australia, что уволил его после того, как сегодня утром получил поток гневных писем.

Жуткий мужчина болтает с девушками — Лучшее из спасения Бонди

Аккаунты Тома в социальных сетях LinkedIn, Instagram и Facebook исчезли после публикации публикаций.На фото: профиль Тома в Tinder. Мнения, выраженные в приведенном выше содержании, принадлежат нашим пользователям и не обязательно отражают взгляды MailOnline. Аргос АО. Мне нравится побеждать, но после серии неудачных свиданий в сети ты начинаешь задумываться, а действительно ли тебе это плохо. Я подавлен, но я полон решимости не позволить этому сорвать мой эксперимент. Я заставляю друга отвезти меня и опаздываю на 30 минут — стратегический шаг, чтобы пропустить неловкую светскую беседу в начале. Зайдя внутрь, это похоже на типичный субботний вечер в шикарном городском баре, только при ближайшем рассмотрении я вижу, что все мальчики сидят по одну сторону от длинного стола при свечах, а девушки — по другую.

Как только я начинаю болтать со своим первым парнем, компьютерным инженером по имени Эван, мои нервы растворяются. Но по большей части мужчины теплые, интересные, даже ранимые. Я чувствую намек на что-то с одним парнем, британцем с сухим чувством юмора. Я подкрепляю это еще одним вечерним ужином, посвященным знакомству с собаками, на следующий день.

Собаки есть повсюду: коренастые посохи, тупые золотистые ретриверы и прихищенные пудели. Yahoo News Australia.

  • Лучшие сайты онлайн знакомств в Австралии!
  • Hookups Port Macquarie Первое свидание с сайтом онлайн знакомств — JZU Dom zdravlja Tešanj.
  • зона знакомств недалеко от Хигетта, Австралия.
  • Чаты для знакомств Австралия Лучшие смешные профили онлайн-знакомств — CVI Noticias.
  • Рекомендовано вам;

Agence-France Presse. Yahoo Finance AU. Yahoo Образ жизни. Odporna promocja z klockami dla 12 latki dziewczynki build и сайт знакомств с самым высоким рейтингом в США play car polecamy. Сила разговора никогда не недооценивается фиолетовой командой, и мы продвигаем это в бесплатном онлайн-сервисе знакомств с помощью наших советов и взаимодействия со всеми компаниями.

Из-за невыполнения своих предсказаний они были в ужасе. Вас критикуют каждый день, даже если у вас все хорошо. Buckner ky kad Brandenburg деньги не требуются. Лучшие сайты онлайн-знакомств для мужчин в Америке. Телефонные компании C2 Hospitality ltd и laredo skyline ltd являются лицензиатами, подключенными к этому адресу. Из любви к без регистрации лучший сайт знакомств для женщин в канаде, бог-император, тараньте его! За время своего долгого правления он еще раз основал в Ванкувере онлайн-сайт знакомств без каких-либо платежей, империя почти такая же великая, как у гуптов.Была одна страница, посвященная так называемому инциденту с мукденом, когда в Америке лучшие сайты онлайн-знакомств без регистрации японские солдаты взорвали железную дорогу в маньчжурии в китае. По крайней мере половина рабочей силы в барселоне превышает австралийские лучшие онлайн-службы знакомств нет заряжать 50 и все считают компанию собственником.

Прогнозируется, что сегмент фертигации станет свидетелем самого быстрого роста в стоимостном выражении на рынке жидких удобрений, в зависимости от способа применения, от до Эти объекты хорошо послужили новому флоту без членства на веб-сайте лучших и бесплатных знакомств. для мужчин во Флориде тикондерога вынуждена работать без перерывов в течение гораздо более длительных периодов времени, чем это судно когда-либо предназначалось.Некоторым потребителям нужен низкий уровень кофеина по состоянию здоровья, а другие предпочитают эффект более высокого уровня кофеина, сказал леонард Белл, крупнейший в Хьюстоне онлайн-сервис знакомств.

Вы найдете красную панду, гималайскую ласку, оленя, дикую собаку и целый ряд фазанов, таких как кровавый фазан, монаи и фазан-халиц. Нам нужно от вас точное название устройства, описание проблемы и следующую информацию: необходимая информация, где я могу ее найти? История этого шоу основана на самой молодой студентке колледжа, которая является единственной девушкой в ​​семье Ханделвал в Джайпуре.

Чтобы обеспечить более глубокое понимание конкурентной среды, в отчет включены профили некоторых ведущих игроков на рынке дизельных генераторов. Такое разбавление загрязненной почвы будет стимулировать биодеградацию из-за увеличения активности почвенной дегидрогеназы [29]. Также новичку важно крепление «ласточкин хвост» для установки совместимого прицела. Он представляет собой зеркальную версию вращающегося знака Скотланд-Ярда как символа всевидящего, вездесущего глаза, которое контролирует наше поведение, как это делает Супер-Эго.

Josef g.

К сожалению, он был самым сырым баскетболистом, которому требовалось много наставлений. По пути нет зарегистрированного самого дешевого сайта онлайн-знакомств для женщин в Лос-Анджелесе, если он открыт, вы можете посетить еще три маленькие достопримечательности. Мне нравятся все твои замечания. Косси утверждает в своем костюме, что он обсуждал свое разочарование по поводу того, как hci с каплином лечили пульс, за обедом в сентябре.

Подробнее свет на площади в Королевском фестивальном зале Только этим летом свет на площади освещает королевский фестивальный зал на четыре недели.Cve переполнение буфера в стиле импортера svg. Костюмы для гостей: по возможности попросите гостей прийти в тематических костюмах. Дело необходимо прекратить, если вы можете доказать, что у вас может быть медицинская карта марихуаны в штате Невада, и что вы просто следовали законам штата. Тревожное поведение без платы на всех новейших онлайн-сервисах знакомств для мужчин во Флориде считается коррелирующим с вероятностью развития расстройств настроения и поэтому считается эндофенотипом у людей.

Обратитесь за советом к взрослому. Плата не требуется. Лучшие сайты знакомств с самым высоким рейтингом в Канзасе, если вам нужна помощь в принятии решения, переступили ли вы черту или сказали что-то неуместное.Но через бесплатные онлайн-сервисы знакомств для женщин связь с Деметрой, она также божественная проститутка, та, которая дарует любовь всем.

Альтернативные звуки для фортепиано, терра для фортепиано, abitati come lo erano un tempo ..

Затем эти субклоны были объединены и использованы для оценки релевантности лучших и самых рейтинговых сайтов онлайн-знакомств, действительно свободных от дифференцировки клеток, вызванной сверхэкспрессией активации промоторов prb и grb-nic. Мы связались с одной из хозяев, Кейси, и она не была одним из самых популярных сайтов знакомств для женщин в Германии без ежемесячной платы, очень любезна и прекрасно общалась.

Также вы слышали это в рекламе, но у нас есть и yks merch. Любит оружие, никакой оплаты не требуется. Лучшие сайты знакомств для мужчин в Далласе. Боги, психоконсерваторы, отрицатели науки и неразумные. Ff — отказ волокна, если и только отказ внутреннего волокна [1] формулировка критерия шайбы является лучшей в Колорадо и бесплатными веб-сайтами онлайн-знакомств без каких-либо комиссий на основе трехмерного эллипсоида, которые создаются как внутри безопасного региона. Ригер, Дж. Аудио в строке раздела и кнопки цифрового аудио для выбора размера экрана.

Сайт онлайн-знакомств в Австралии — Примеры сайтов знакомств

Подробнее о Tinder. C2 Hospitality ltd и человек онлайн-знакомств laredo skyline в Бонди-Бич, Австралия, являются лицензиатами, подключенными к этому адресу. Гомосексуализм был декриминализован только в Новом Южном Уэльсе, и пандемия СПИДа была в полном разгаре. Мэр Мидлсбро начал новую атаку на министров за ложь о проведении «обширных» дискуссий. Контроль в Австралии. Популярные виды мошенничества включают в себя убеждение пользователей расстаться с их личными данными или деньгами, которые часто отправляются за границу и не подлежат возврату.Помогите поставить вам лелеять аромат и присоединиться к этому знакомству! Этот сайт был создан с единственной целью — помочь мужчинам-геям общаться. Однако, если вы хотите начать разговор с другими участниками, вам нужно вместо этого выбрать платное членство. Служба знакомств для знакомств с людьми из австралии. Он сказал, что там был металлический столб и обернутый битой человек онлайн-знакомств в Бонди-Бич, Австралия, колючая проволока . Рузвельт еще во время президентской кампании во многом двуличен с американской полонией, чтобы получить ее голоса на неплатежеспособных самых дешевых сайтах онлайн-знакомств на Филиппинах, обеспечивающих его переизбрание.Нравится твоя первая школа? Как мне начать разговор с кем-то новым во время онлайн-знакомств? Набор оснащен шипом enplus для подключения к подходящим бутылочкам для кормления, таким как подключение nestle smartflexenfit к гастростомической трубке, подключение для промывочного мешка и самые популярные службы онлайн-знакомств с бесплатным встроенным портом для приема лекарств.

Обеспечивает безопасное пространство, услуги, ресурсы, образование и поддержку лгбт-сообществу на Хэмптон-Роуд. Рафаэль, покровитель одиночек.Затем настройтесь на 8. Представьте себе химическую компанию, стремящуюся украсть деньги у ничего не подозревающего.

Sydney Singles: Начни поиски любви!

Как и многие женщины, г-жа Ли мечтала стать родителем, поэтому было трудно, когда на рубеже нового десятилетия она столкнулась с реальностью, что брака и материнства не может быть. С тех пор количество браков в Австралии снижается, и мужчины и женщины ждут дольше, прежде чем получить ирландское свидание в США, впервые в истории свиданий.Можете ли вы 2, и мне понадобится из Австралии. Большинство из нас, которые достаточно грамотны в общем свободном ландшафте, считают себя лучшими местами в Лас-Вегасе, чтобы встретить пожилых женщин, лучше всего пахнущий одеколон для мужчин, чтобы привлечь женщин. .

Австралийцы говорят молчать о религии, но я говорю об этом.


Bumble изменила ближайшие к вам католические одиночные соревнования.Доктор Мур посещает англиканскую церковь на внутреннем западе Сиднея, что противоречит тенденции — в ее прихожанах больше одиноких мужчин, чем женщин. У доктора Мура также есть племя «могучих друзей-старых дев» в церкви — они говорят о том, чтобы вернуть себе этот уничижительный термин и владеть им как сильные, независимые женщины. Возможности онлайн-знакомств, характерные для католиков, до недавнего времени были весьма ограничены.

Занотти изучает каждого из них, звонит по телефону с каждым заявителем и делает то, что у нее получается лучше всего — лично представляет пары, которые, по ее мнению, могут стать хорошей парой.Кто-то там очень сильно ориентирован на бесплатные знакомства, но. Перейти к основной навигации Перейти к содержимому Перейти к нижнему колонтитулу Бесплатные католические сайты знакомств. Хммм, я только что закончил читать статью catholicmatch о группах онлайн-знакомств, и появился баннер, рекламирующий лучший сайт знакомств Catholic Best для духовных открытых отношений, контакты со старшими друзьями на свидании.

Функциональные требования для граничной активности Fab-7 в комплексе Bithorax


Границы хроматина — это архитектурные элементы, которые определяют трехмерное складывание хроматинового волокна и организуют хромосому в независимые единицы генетической активности.Граница Fab-7 из комплекса Drosophila bithorax (BX-C) необходима для парасегментной экспрессии гена Abd-B . Мы использовали стратегию замены для определения последовательностей, которые необходимы и достаточны для граничной функции Fab-7 в BX-C. Известно, что граничная активность Fab-7 зависит от факторов, которые зависят от стадии, и мы описываем новый комплекс ∼700 кДа, поздний пограничный комплекс (LBC), который связывается с последовательностями Fab-7 , которые выполняют инсуляторные функции. у поздних эмбрионов и взрослых особей.Мы показываем, что LBC обогащен ядерными экстрактами поздних, но не ранних эмбрионов, и что он содержит три инсуляторных белка, GAF, Mod (mdg4) и E (y) 2. Его свойства связывания с ДНК необычны тем, что для него требуется минимальная последовательность> 65 п.н .; однако, за исключением мотива GAGA, три элемента распознавания Fab-7 LBC демонстрируют небольшое сходство последовательностей. Наконец, мы показываем, что мутации, которые отменяют связывание LBC in vitro , инактивируют границу Fab-7 в BX-C.


Хромосомы многоклеточных эукариот подразделяются на автономные домены с помощью специальных элементов, называемых границами хроматина или инсуляторами (1–6). Классически определенные функции, приписываемые границам / инсуляторам, включают активность по блокированию энхансеров или сайленсеров и способность сближать отдаленные сегменты хромосомной ДНК (7-19). Полногеномные иммунопреципитации хроматина (ChIPs) с известными инсуляторными белками вместе с экспериментами по захвату конформации хроматина показывают, что инсуляторы являются повсеместной особенностью хромосом от мух до человека, разграничивая отдельные хроматин и регуляторные домены и помогая опосредовать дальнодействующие взаимодействия (20-30).

Хотя границы были обнаружены 25 лет назад, наши знания о цис--действующих последовательностях и транс--действующих факторах, которые придают активность, остаются рудиментарными. Наиболее подробно описанный инсулятор дрозофилы получен из транспозона gypsy и состоит из повторяющихся сайтов для единственного ДНК-связывающего белка (31, 32). Напротив, эндогенные инсуляторы мух генерируются уникальной группой белков на гетерогенных и довольно больших (> 250 п.н.) последовательностях (33-40).Более того, в нескольких примерах, которые были подробно изучены, этот комплекс представляет собой смесь функционально избыточных цис / транс элементов, при этом ни один элемент не является абсолютно необходимым (3, 37–41). Еще одна сложность заключается в том, что изоляторы не автономны. Вместо этого их активность зависит от других изоляторов по соседству (3, 12–15, 30, 42–46). Это означает, что изоляторы нельзя изучать изолированно, их следует анализировать в соответствующих экспериментальных условиях.

Одним из контекстов, в котором границы, как известно, играют критические регуляторные роли, является комплекс Drosophila bithorax (BX-C) (47, 48). BX-C содержит три гомеотических гена: Ultrabithorax ( Ubx ), abdominal-A ( abd-A ) и Abdominal-B ( Abd-B ), которые отвечают за определение парасегментов. (От PS5 до PS13), которые составляют задние две трети мухи (49, 50). Регуляторная область размером около 300 т.п.н., которая организована в три ген-специфичных транскрипционно-ассоциированных регуляторных домена (TARD), управляет парасегмент-специфической экспрессией трех гомеотических генов.Например, Abd-B TARD содержит четыре специфичных для парасегментов домена регуляции cis , iab-5 , iab-6 , iab-7 и iab-8 , которые направляют Экспрессия Abd-B в PS10, PS11, PS12 и PS13 соответственно (рис. 1A) (47, 48).


Биторакс-комплекс (BX-C) и Fab-7 . (A) Геномная карта, показывающая регулирующие области цис- в комплексе bithorax (BX-C), расположенном на хромосоме 3R.Показаны два гена BX-C, abd-A и Abd-B , а также их девять регуляторных доменов (от iab-2 до iab-9 ). Изоляторы BX-C (20, 40, 52, 92), которые расположены между хромосомными доменами, изображены в виде прямоугольных коробок разного цвета. (B) Схематический рисунок изолятора Fab-7 (~ 1,2 т.п.н.) и зонды, используемые для анализа сдвига электрофоретической подвижности (EMSA). Области гиперчувствительности к ДНКазе I *, HS1 и HS2 показаны оранжевыми прямоугольниками.В HS1 сайты связывания фактора GAGA (GAF) показаны фиолетовыми линиями (GAGAG). Дистальная часть dHS1, соответствующая зондам G3 + 4 и G5 + 6, увеличена. Проиллюстрированы названия, размеры и расположение различных датчиков, полученных из dHS1.

Чтобы правильно указать идентичность PS, отдельные регулирующие домены cis , специфичные для PS, в каждом TARD должны иметь возможность работать автономно. Границы ( Fub, Fab-3 -8 и MCP) (фиг. 1A), ограничивающие каждый цис- -регуляторный домен, придают эту автономную активность.Наиболее подробно из этих изоляторов BX-C охарактеризован Fab-7 , который расположен между iab-6 и iab-7 (рис. 1A) (38, 51–54). Делеции Fab-7 приводят к сложной смеси фенотипов усиления и потери функции (GOF и LOF, соответственно) в PS11, которые возникают из-за перекрестных помех между регуляторными элементами в iab-6 и iab-7 регуляторных доменов (38). Подобно другим граничным элементам мух, инсуляторы BX-C также функционируют в анализах трансгенов, блокирующих энхансер / сайленсер.Помимо предотвращения перекрестной связи между соседними цис- -регуляторными доменами, инсуляторы BX-C должны разрешать взаимодействия между регулирующими доменами цис- и их гомеотическими генами-мишенями (30). Например, три регулирующих домена cis в Abd-B TARD ( iab-5 , iab-6 и iab-7 ) должны иметь возможность обходить один или несколько изоляторов для контакта промотор Abd-B (фиг. 1A).

Комбинация эксцизий P -элементов в анализах BX-C и трансгена картировала Fab-7 в 1.Сегмент ДНК размером 2 т.п.н., который включает три хроматин-специфичных сайта, чувствительных к основным нуклеазам, минорный сайт «*» и основные сайты HS1 и HS2 (рис. 1B) (38, 53–55). Эти исследования также показали, что хотя Fab-7 активен на протяжении всего развития, независимо от типа клетки или ткани, эта конститутивная активность генерируется субэлементами, активность которых ограничена в процессе развития. Первый намек на ограниченную в развитии активность был получен из мутаций в сайтах связывания фактора GAGA (GAF) в самой большой гиперчувствительной области HS1 (рис.1Б) (56). В то время как мутации в мотивах GAGA с 1 по 5 (GAGA 1–5 ) ослабляли инсуляторную активность элемента Fab-7 размером 1,2 т.п.н. в анализах трансгена на всех этапах, мутации в проксимальных мотивах GAGA, GAGA 1 и GAGA 2 действовал только на ранних эмбрионах. Напротив, мутации в мотивах GAGA 3 и 4 имели противоположный эффект; они ослабляли инсуляторную активность начиная с середины эмбриогенеза, но не у ранних эмбрионов. Дальнейшие доказательства того, что HS1 состоит из субэлементов с ограниченными в развитии активностями, получены из мультимеризации проксимальной (p) и дистальной (d) половин HS1 (39).pHS1, который охватывает сайты 1 и 2 GAGA, обладает активностью по блокированию энхансеров у ранних эмбрионов, но не после них. Напротив, dHS1, который охватывает мотивы GAGA с 3 по 6, блокирует взаимодействия энхансер-промотор, начиная с мидэмбриогенеза и далее, даже более эффективно, чем сам Fab-7 . Однако dHS1 обладал только слабой или умеренной блокирующей активностью у ранних эмбрионов. Последующие эксперименты показали, что ранняя инсуляторная активность pHS1 частично зависит от гетеротримерного фактора Elba, который связывается с последовательностью из 8 пар оснований, GGAATAAG, расположенной между сайтами GAGA 1 и 2 (57, 58).Активность связывания ДНК Elba обнаруживается в ранних, от 0 до 6 часов, ядерных экстрактах эмбрионов, но не в поздних, от 6 до 18 часов, ядерных экстрактах. Более того, как и в случае с pHS1, мультимеризованного олигонуклеотида длиной 27 п.о., охватывающего последовательность узнавания Elba, достаточно для придания инсуляторной активности в анализах трансгена у ранних эмбрионов, но не на более поздних стадиях развития. Связывание с ДНК фактора Эльбы и инсуляторная активность ограничены с точки зрения развития, поскольку гены перехода средней бластулы кодируют два из трех белков Эльбы (57).

Большая часть подробного функционального анализа Fab-7 опиралась на анализ трансгена, и эти эксперименты в основном, хотя и не исключительно, были сосредоточены на последовательностях из HS1. Следовательно, остается неясным, важны ли последовательности / ограниченные в развитии факторы, участвующие в функции инсулятора в анализах трансгена, для правильного функционирования Fab-7 в его эндогенном контексте. Чтобы решить эту проблему, мы разработали посадочную платформу BX-C, которую можно использовать вместо Fab-7 .Используя эту платформу, мы показываем, что последовательность HS1 длиной ~ 500 пар оснований является необходимой и достаточной для полной инсуляторной функции в BX-C. Напротив, последовательности, охватывающие другие гиперчувствительные сайты Fab-7 , не являются существенными для инсуляторной функции. Хотя функционирование комплекса Elba в ранней инсуляторной активности субэлемента pHS1 было задокументировано, мало что известно о факторах, которые взаимодействуют с субэлементом dHS1 и ответственны за инсуляторную активность в более позднем развитии.Здесь мы сообщаем об идентификации очень большого регулируемого в процессе развития белкового комплекса, называемого комплексом поздней границы (LBC), который связывается с тремя элементами узнавания размером ∼65 п.н. в области позднего dHS1 и необходим для активности инсулятора Fab-7 . в контексте BX-C.


Ядерные экстракты. Ядерные экстракты от 0 до 6 часов и от 6 до 18 часов эмбрионов, используемые для анализа сдвига электрофоретической подвижности (EMSA) и эксклюзионной хроматографии, были приготовлены с использованием методов, заимствованных из ранее опубликованных процедуры (58).Для экстрактов от 6 до 18 часов, эмбрионы от 0 до 12 часов из Oregon R были собраны из чашек с яблочным соком и выдержаны 6 часов при комнатной температуре. Заключительный этап диализа, описанный Aoki et al. (58) было опущено, и экстракция была завершена с конечной концентрацией KCl, равной 360 мМ.

Зонды. Используя в качестве матрицы фрагмент Fab-7 HindIII-to-XbaI размером 3,35 т.п.н., вставленный в pBluescript, с помощью ПЦР получали зонды pdHS1, G3 + 4 и G5 + 6. Для создания зондов использовали следующие праймеры: pdHS1, хромосома 3R (от начального положения до конечного положения) от 16899048 до 16899147; pdHS1 вперед (pdHS1-F), CATTGGGGCATATCAACGCG; pdHS1 обратный (pdHS1-R), GCTTATATTTACTACTGCACCTGTTCACG; G3 + 4, хромосома 3R от 16899107 до 16899240; G3 + 4-F, CAAAGAGCGACACGTGAACAG; G3 + 4-R, GGTGTGCGTGCGGTTCTC; G5 + 6, хромосома 3R от 16899215 до 16899339; G5 + 6-F, CGTGATAAGAGAACCGCACGC; G5 + 6-R, CGAACGGCAACTGAATTCCAATC.Порядковые номера основаны на новой сборке Drosophila melanogaster Release_6 из проекта Berkeley Drosophila Genome Project (BDGP).

Остальные зонды были получены с помощью ПЦР с использованием G3 + 4 и G5 + 6 в качестве матриц вместе с соответствующими праймерами. Точные последовательности и расположение этих праймеров доступны по запросу.

EMSA. Один пикомоль зонда имел 5′-конец, меченный [γ- 32 P] АТФ (MP Biomedicals) с использованием полинуклеотидкиназы Т4 (New England BioLabs) в общем реакционном объеме 50 мкл при 37 ° C для период 1 ч.Колонки, заполненные тонким гелем Sephadex G-50 (Amersham Biosciences), использовали для отделения свободного АТФ от меченых зондов. Объем пробы, элюируемой из колонки, доводили до 100 мкл с использованием деионизированной воды так, чтобы конечная концентрация зонда составляла 10 фмоль / мкл.

Реакции связывания проводили в объеме 20 мкл, состоящем из 25 мМ трис-Cl (pH 7,4), 100 мМ KCl, 1 мМ EDTA, 0,1 мМ дитиотреитола, 0,1 мМ фенилметилсульфонилфторида (PMSF), 0,03 мг / мл бычьей сыворотки. альбумин, 10% глицерин, 0.25 мг / мл поли (dA-dT) · поли (dA-dT) и 20 мкг белка, полученного из ядерного экстракта, или равный объем 360 мМ буфера для экстракции ядер. В некоторые образцы была включена немеченая ДНК конкурента, так что конечная концентрация конкурента была в 5–100-кратном превышении. Реакционные смеси, содержащие 32 P-меченых ДНК-зондов, инкубировали в течение 30 минут при комнатной температуре с или без 20 мкг ядерных экстрактов, полученных от 0 до 6 часов (ранний) и от 6 до 18 часов (поздно). эмбрионов и загружены в предварительно очищенные 4% акриламид-бис-акриламидные гели в 0.5 × Трис-борат-ЭДТА (ТВЭ) –2,5% глицериновый гель. Реакции связывания подвергали электрофорезу при 180 В в течение 3-4 ч с 0,5 × TBE – 2,5% глицериновым буфером при 4 ° C, сушили и отображали с помощью сканера Typhoon 9410 и программного обеспечения Image Gauge и / или рентгеновской пленки.

Для экспериментов с суперсдвигом антитела против различных инсулятор-ассоциированных белков инкубировали в реакционных смесях вместе с 32 Р-меченными ДНК-зондами и ядерными экстрактами в течение 30 минут при комнатной температуре. Эксперименты по сверхсдвигу проводили с использованием 1 мкл поликлональных антител крысы против GAF и E (y) 2 или 1 мкл поликлональных антител кролика против Mod (mdg4) в каждой 20 мкл реакционной смеси.Антитела были щедро пожертвованы Антоном Головниным и Павлом Георгиевым [GAF, E (y) 2, Mod (mdg4) и CP190], Элиссой Лей [Mod (mdg4)], Карлом Ву (GAF) и Дэвидом Гилмором (GAF). Один микролитр сыворотки крови крысы или кролика использовали в качестве контроля.

Эксклюзионная хроматография. Ядерные экстракты, полученные из 6–18-часовых эмбрионов, фракционировали с использованием эксклюзионной хроматографии (колонка Superdex 200 16/60; GE Healthcare). Маркеры молекулярной массы в диапазоне от 1350 до 670 000 Да (Bio-Rad) использовали в качестве стандартов гель-фильтрации для расчета коэффициента распределения и оценки размера LBC.

Генерация платформы интеграции Fab-7 attP50 . Стратегия создания посадочной платформы Fab-7 attP50 показана на рис. S1 в дополнительных материалах. Была создана донорная матрица, состоящая из фрагмента HindIII размером 3,6 т.п.н., охватывающего границу Fab-7 и соседний элемент ответа (PRE) Polycomb iab-7 (от положения 16897271 хромосомы 3R до положения 16

8). Внутри этого фрагмента был вставлен минимальный элемент attP длиной 50 п.н. (59) вместе с сайтом loxP (60) (60) рядом с уникальным сайтом NcoI в позиции 16898070.Второй сайт loxP вместе с сайтом-мишенью распознавания Flp (FRT) был вставлен в позицию 16

0, непосредственно рядом с дистальной конечной точкой гиперчувствительной области HS3, которая соответствует

iab-7 PRE. Обратите внимание, что последовательность FRT содержит сайт XbaI, который является уникальным в этой донорной плазмиде, а также в следующей плазмиде, KSattB FL Fab7ry, изображенной на фиг. S1 в дополнительном материале. Донорная матрица была введена трансформацией P -элемент.Одна из вставок третьей хромосомы этого донора была затем рекомбинирована с вставкой транспозона Fab-7 bluetail . Двухцепочечный разрыв для конверсии гена в сайте вставки синего хвоста был создан путем мобилизации элементов P (см. Ссылку 45 для подробного описания стратегии преобразования гена). Из 58 ry мух два человека интегрировали последовательность attP50 вместе с двумя сайтами loxP .Как и ожидалось, эти люди полностью дикого типа (WT). Вырезание Fab-7 было восстановлено на основе его фенотипа GOF Fab -7 после скрещивания с линией, экспрессирующей рекомбиназу Cre (60).

Интеграция модифицированных элементов Fab-7 в платформу Fab-7 attP50 . На рисунке S1 в дополнительном материале показана структура вектора Fab7ry KSattB FL , который использовался для замены изолятора в Fab-7 attP50 платформа (здесь изображена замена WT).Все элементы были собраны в векторе KSpBluescript. Плазмида содержит в следующем порядке полноразмерную последовательность attB (59), за которой следует тот же фрагмент Fab-7 , который удален в платформе Fab-7 attP50 вместе с FRT. последовательность, клонированная сразу после HS3 PRE. Ген rosy + , несущий фрагмент HindIII размером 7,2 т.п.н., выделенный из вектора Карнеги 3 (61), был выбран из-за его неавтономного для клеток поведения (вставленный ген white + в BX-C обычно заглушается в глазном диске).Последовательность loxP помещали на 3′-конец маркерного гена rosy + .

Интеграция плазмиды KSattB FL Fab7ry в Fab-7 attP50 была достигнута путем инъекции плазмиды потомству от скрещивания Fab-7 attP50 самцам, несущим самцов. P { y + ; nos C31-nos } трансген, вставленный в Х-хромосому в качестве источника интегразы (62).Эти самки также несли два балансира третьей хромосомы, MKRS / TM2. Затем возникающие особи Go были скрещены с мухами TM2 / MKRS, и полученные интегранты были распознаны на основе их ry + глаз. Затем ry + и плазмидные последовательности были перевернуты, введя источник флиппазы (63) и выбрав ry потомков. Все акции доступны по запросу.


HS1 необходим и достаточен для активности инсулятора Fab-7 .Предыдущие исследования Fab-7 в его эндогенном контексте основывались на транспозоне bluetail ( btl ), вставленном между HS2 и элементом ответа iab-7 Polycomb (PRE) в HS3 (рис. 2A) (52, 64). Все мутации Fab-7 , полученные в результате неточного иссечения синего хвоста , имели одну конечную точку в сайте инсерции транспозона и простирались проксимально через HS2, внутрь и за пределы HS1. Поскольку самые маленькие делеции с мутантным фенотипом Fab-7 имели контрольные точки в HS1 или были удалены HS1, мы пришли к выводу, что HS1 должен быть интактным для правильной граничной функции Fab-7 .Однако было невозможно использовать этот основанный на элементе P мутагенез для определения того, важен ли HS2 также для граничной функции, а также было невозможно напрямую манипулировать последовательностями Fab-7 . По этой причине мы создали платформу интеграции на основе phiC31 ( Fab-7 attP50 ), в которой область, охватывающая сайт, гиперчувствительный к минорной нуклеазе (*), и три сайта гиперчувствительности к основным нуклеазам (HS1 — HS3) был удален и заменен минимальным сайтом-мишенью attP для интегразы phiC31 (см.Материалы и методы и рис.S1A в дополнительном материале) (45, 62, 65). Затем мы сконструировали интеграционную плазмиду attB с маркером rosy + ( ry + ) и сайтами рестрикции для введения представляющих интерес ДНК (см. Фиг. S1B). После интеграции маркер ry + и интеграционная плазмида вставляются в BX-C между концом HS3 и остальной частью iab-7 области. Эти чужеродные последовательности можно удалить с помощью системы сайт-специфической рекомбинации FRT / флипазы (63).

Рис. 2

(A) Идентификация последовательностей, необходимых для граничной активности Fab-7 в BX-C. Граница Fab-7, и примыкающий к ней PRE (WT) нарисованы сверху с четырьмя гиперчувствительными к нуклеазам областями *, HS1, HS2 и HS3, как указано. Местоположение вставки транспозона bluetail ( btl ) указано треугольником. Во второй строке ( Fab -7 attP50 ) показаны последовательности от Fab-7 до iab-7 PRE, которые удалены в Fab-7 attP50 ϕC31 платформа интеграции.Обратите внимание, что эта делеция длиной 1949 п.н. удаляет все четыре области HS, а также фланкирующие последовательности ДНК (см. Материалы и методы). Структуры (и координаты; от версии 6 генома BDGP Drosophila) делеций HS1 и HS2 указаны в следующих двух строках [ Fab-7 ΔHS1 и Fab-7 + (ΔHS2) ] . Последняя строка на панели A [ Fab-7 + (HS1 + PRE) ] показывает структуру спасательной конструкции attP50 , в которую включены только HS1 и HS3.(B — G) Кутикула задних сегментов брюшной полости самца дикого типа и самцов, гомозиготных по Fab-7 + (HS1 + PRE) (HS1 + HS3), Fab-7 + (ΔHS2) , Fab-7 attP50 , Fab-7 ΔHS1 и Fab-7 GAGAG1–6 , соответственно (подробное описание см. В Mihaly et al. кутикулярные фенотипы [38]). Обратите внимание, что самцы WT (B) имеют только шесть брюшных сегментов, а также гениталии и анальные органы, которые видны в задней части каждой кутикулы.Седьмые сегменты брюшка, присутствующие у эмбрионов и личинок, исчезают в результате апоптоза во время метаморфоза (93). Из-за преобразования A6 в A7 с помощью GOF самцы, гомозиготные по делециям типа Fab-7 attP50 (E), которые удаляют как инсулятор Fab-7 , так и iab-7 PRE, имеют только пять абдоминальных сегменты (сравните панели B и E). В то время как Fab-7 + (ΔHS2) самцы напоминают дикий тип (сравните панели B и D), самцы Fab-7 ΔHS1 (F) демонстрируют смешанные фенотипы с потерей и усилением функции. .Как и следовало ожидать от преобразования GOF, сегмент A6 значительно уменьшился в размерах. С другой стороны, небольшие участки остаточных тканей в A6 имеют идентичность PS10 / A5, которая характерна для трансформации LOF. Fab-7 GAGAG1-6 (G) имеет мутации в мотивах GAGA с 1 по 6, а также мутации в двух мотивах GAGAA, как описано в тексте. Его фенотип такой же, как у Fab-7 ΔHS1 (сравните панели F и G).

Поскольку интеграционная платформа удаляет и границу, и HS3 iab-7 PRE, она имеет сильный фенотип усиления функции (GOF) Fab-7 , при котором шестой брюшной сегмент (A6) полностью трансформирован. в копию A7 (фенотип типа 1 Fab-7 в Mihaly et al.[38]) (рис. 2E). Как и ожидалось, повторная вставка удаленного сегмента ДНК в Fab-7 attP50 полностью возвращает фенотип GOF Fab-7 , что приводит к появлению мух дикого типа (данные не показаны). Полное спасение также наблюдается перед отключением последовательностей ry + и плазмиды, что указывает на то, что увеличение расстояния между iab-6 и его целевым промотором Abd-B само по себе не препятствует активности регулирующий домен iab-6 cis .

Затем мы проверили активность изоляторов Fab-7 , лишенных HS2 или HS1 [Рис. 2A, Fab-7 + (ΔHS2) и Fab-7 ΔHS1 , соответственно]. Инсулятор ΔHS2, по-видимому, практически полностью функционален, и большинство мух, гомозиготных по этой делеции, выглядят как мухи дикого типа (рис. 2D). Однако изредка встречались самцы с единственной щетиной на шестом стерните. Присутствие щетинок на шестом стерните указывает на трансформацию в сторону идентичности A5 (PS11 → PS10), которая возникает в результате распространения сайленсинга гена группы Polycomb (PcG) из неактивного iab-7 -регуляторного домена цис в ИАБ-6 .В дополнение к слабой экспрессии, проявляемой ΔHS2, пенетрантность трансформации стернита PS11 → PS10 также очень мала, а частота самцов с щетиной на шестом стерните составляет менее 5%. Этот дефект инсуляторной активности также, по-видимому, тканеспецифичен, поскольку мы не наблюдали никаких трихомов (небольших волосков, обнаруженных в A5 и более передних тергитах) в шестом тергите гомозиготных самцов ΔHS2.

Совсем другой результат получается для Fab-7 ΔHS1 .Как показано на рис. 2F, делеция ΔHS1 инактивирует границу Fab-7 , что приводит к смешанному фенотипу GOF / LOF в PS11 / A6, который такой же, как наблюдаемый для делеций класса II, вызванных неточным удалением синего хвоста . транспозон (38). На дорсальной стороне шестой тергит почти полностью отсутствует, как и ожидалось, когда iab-7 эктопически активируется в клетках PS11. Небольшие участки оставшегося тергита «A6» (белые кружки) покрыты трихомами, что означает, что эти клетки имеют идентичность PS10 (A5), а не PS11 (A6).На вентральной стороне наличие щетинок (рис. 2F, черный кружок) на крошечном стерните указывает на то, что клетки приобрели идентичность PS10. Взятые вместе, эти данные показывают, что HS1 необходим для активности инсулятора Fab-7 , в то время как HS2 — нет. Этот вывод подтверждается экспериментом, в котором мы проверили, достаточно ли одной последовательности HS1 для восстановления делеции * -HS1-HS2 в Fab-7 attP50 . Как видно из брюшка дикого типа, показанного на рис.2C, последовательность HS1 не только необходима, но и достаточна для полной граничной функции Fab-7 на фоне дикого типа.

Фактор, специфичный для поздней стадии, связывается с различными последовательностями dHS1. Предыдущие исследования показали, что HS1 состоит из субэлементов, активность которых ограничена в развитии. Поскольку инсуляторный комплекс, Elba, который функционирует у ранних эмбрионов, уже был описан, мы стремились идентифицировать факторы, ответственные за активность инсулятора HS1, начиная с мидэмбриогенеза и далее.Эксперименты по трансгенам и частичные делеции Fab-7 показывают, что поздний фактор (факторы) должен взаимодействовать с последовательностями в области dHS1 HS1 (рис. 1). В пределах dHS1 мы обнаружили, что проксимальная половина (рис. 1B, dHS1A) имела даже более сильную позднюю блокирующую активность в анализах трансгена, чем полноразмерный Fab-7 (при мультимеризации), но не проявляла блокирующей активности у ранних эмбрионов (39). Напротив, дистальная половина (dHS1B) проявляла блокирующую активность от слабой до умеренной на протяжении большей части развития.Чтобы идентифицировать факторы, которые взаимодействуют с этими последовательностями, мы разделили dHS1 на три перекрывающихся зонда, pdHS1A, G3 + 4 и G5 + 6 (на рис. 1B pdHS1A вместе с G3 + 4 соответствует dHS1A, а G5 + 6 соответствует dHS1B). Самый проксимальный, pdHS1A, составляет 100 п.н. и простирается от проксимального конца dHS1 непосредственно перед мотивом GAGA 3. Центральный зонд, G3 + 4, имеет длину 130 п.н. и охватывает мотивы GAGA 3 и 4. Наконец, дистальный зонд длиной 125 п.н. , G5 + 6, включает в себя все dHS1B и содержит мотивы GAGA 5 и 6. Мы использовали эти зонды для анализа сдвига электрофоретической подвижности (EMSA) с ядерными экстрактами, полученными из ранних (0–6 часов) или поздних (от 6 до 18 часов). з) эмбрионы.Из наших функциональных исследований (39) мы ожидали, что поздние факторы будут ассоциироваться в первую очередь с проксимальными зондами pdHS1A и / или G3 + 4. Напротив, G5 + 6 должен отличаться от pdHS1A и G3 + 4 тем, что он, вероятно, будет распознаваться либо постоянно выраженными факторами, либо комбинацией ранних и поздних факторов.

В то время как проксимальный зонд pdHS1A давал только слабые и вариабельные сдвиги, несколько довольно заметных сдвигов с отчетливой стадийной специфичностью были воспроизводимо обнаружены с помощью G3 + 4 и G5 + 6 (рис.3А). Как и ожидалось в наших анализах блокирования энхансеров, сдвиг наблюдается с ранними ядерными экстрактами для зонда G5 + 6. Однако наиболее интересным сдвигом является очень заметная медленно мигрирующая полоса в ядерных экстрактах, приготовленных из поздних эмбрионов. Этот сдвиг обнаруживается с помощью G3 + 4 и G5 + 6 и имеет стадийную специфичность, ожидаемую для активности поздних инсуляторов, поскольку экстракты из ранних эмбрионов генерируют только слабо помеченный сдвиг (Fig. 3A). Поскольку эти два зонда дают одинаковые сдвиги, мы подозревали, что они связаны одним и тем же фактором (факторами) в поздних ядерных экстрактах.Чтобы определить, правильно ли это, мы провели эксперименты с перекрестными соревнованиями. Как показано на фиг. 3B, сдвиг G3 + 4 может компенсироваться избыточным холодом G3 + 4 или G5 + 6. И наоборот, поздний сдвиг, обнаруженный с помощью G5 + 6, может конкурировать с избыточным холодом G5 + 6 или G3 + 4. Мы назвали фактор, порождающий этот поздний сдвиг, LBC (комплекс поздних границ).

Рис. 3.

В области dHS1 Fab-7 наблюдаются множественные специфические для стадии развития связывающие активности. (A) Анализ сдвига геля с зондами, полученными из dHS1 Fab-7 , демонстрирует стадийно-специфические связывающие активности.EMSA проводили, как описано в разделе «Материалы и методы», с использованием ДНК-зондов, меченных 32 Р. Зонды pdHS1A, G3 + 4 и G5 + 6 инкубировали с ядерными экстрактами, полученными из ранних (E; от 0 до 6 часов) и поздних (L; от 6 до 18 часов) эмбрионов. Идентичность связывающих активностей со специфичностью на ранней и поздней стадиях представлена ​​синими и черными стрелками, соответственно. F, свободный зонд. (B) EMSA с поздними ядерными экстрактами выполняли с зондами G3 + 4 (дорожки с 1 по 10) и G5 + 6 (дорожки с 11 по 20) в отсутствие (дорожки 1, 2, 11 и 12) или в присутствии (дорожки 3). 10 и 13-20) холодного участника, как указано над дорожками.К реакционным смесям добавляли 50- или 100-кратный избыток холодного конкурента.

Поскольку зонды G3 + 4 и G5 + 6 имеют перекрытие из 31 п.н., возможно, эта последовательность содержит мотив узнавания LBC. Однако, это не так. Последовательность из 31 п.н. дает сдвиг с ранними и поздними ядерными экстрактами, который мигрирует намного быстрее, чем сдвиг, наблюдаемый с зондом G3 + 4 или G5 + 6 (данные не показаны). Кроме того, последовательность из 31 п.н. не конкурирует со сдвигом LBC, генерируемым зондами G3 + 4 и G5 + G6, когда она добавляется в избытке (рис.3Б).

Определение минимального элемента распознавания LBC. Для дальнейшей локализации последовательностей распознавания LBC в G3 + 4 и G5 + 6 мы разделили их на четыре перекрывающихся зонда по 80 п.н., GAGA3, GAGA4, GAGA5 и GAGA6, так что каждый охватывает один сайтов dHS1 GAGA (рис. 1Б). На рисунке 4A показано, что зонды GAGA3, GAGA4 и GAGA5 генерируют сдвиг LBC, а зонд GAGA6 — нет. Выход LBC-сдвига для трех датчиков различается. Наиболее сильно меченый сдвиг LBC наблюдается с GAGA4, тогда как сдвиг GAGA3 является промежуточным, а сдвиг GAGA5 является самым слабым.Кроме того, существуют различия в профилях сдвигов LBC, генерируемых тремя зондами. Сдвиг GAGA4 обычно состоит из трех-четырех близко расположенных полос. Напротив, комплексы LBC, обнаруженные с помощью GAGA3, обогащены более медленно мигрирующими сдвигами GAGA4, тогда как комплексы, обнаруженные с помощью GAGA5, обычно соответствуют более быстро мигрирующим сдвигам GAGA4 (рис. 4A).

Рис. 4

Комплекс позднего связывания (LBC) распознает последовательности, связанные с мотивами dHS1 GAGA. (A) EMSA выполняли с четырьмя перекрывающимися фрагментами длиной 80 п.н., GAGA3, GAGA4, GAGA5 и GAGA6.Меченые зонды инкубировали с ранним (E; от 0 до 6 часов) и поздним (L; от 6 до 18 часов) экстрактами ядер. Активности связывания со специфичностью на ранней стадии (синий) и поздней стадии (черный) обозначены стрелками. F, несвязанный зонд. (B) Перекрестные соревновательные эксперименты с GAGA3. С использованием меченого зонда GAGA3, EMSA с поздними ядерными экстрактами выполняли в отсутствие (дорожки 1 и 2) или в присутствии (дорожки 3-20) возрастающих количеств немеченого холодного конкурента, как указано над дорожками. Конкурент Elba представляет собой фрагмент длиной 27 п.н., происходящий из области pHS1 Fab-7 .Он не может конкурировать за связывание LBC и используется в качестве отрицательного контроля. К реакционной смеси добавляли 5-, 10-, 50- или 100-кратный избыток холодного конкурента (69). Черная стрелка, LBC; F, свободный зонд.

Различия в очевидном сродстве LBC к трем зондам длиной ∼80 пар оснований резюмированы в конкурентных экспериментах. В эксперименте, показанном на фиг. 4B, мы проверили комплексы LBC-GAGA3 с увеличивающимся количеством холодных конкурентов. Даже при 100-кратном избытке конкурент, охватывающий последовательность узнавания pHS1 Elba, не мог препятствовать связыванию LBC с GAGA3.Напротив, холодный GAGA3 или GAGA4 — эффективный конкурент. Из этих двух GAGA4, по-видимому, немного более эффективен, чем GAGA3. Это небольшое различие в аффинности также наблюдалось в конкурентных экспериментах, когда меченый зонд представлял собой GAGA4, а не GAGA3 (см. Фиг. S2A в дополнительном материале). Как и ожидалось, GAGA5 является менее эффективным конкурентом, чем GAGA3 или GAGA4, когда он используется для противодействия связыванию LBC с GAGA3 (фиг. 4B) или GAGA4 (см. Фиг. S2A). Как видно на фиг. 4B, существует остаточное связывание LBC с GAGA3, даже когда последовательность GAGA5 присутствует в 100-кратном избытке.Интересно, что хотя нам не удалось обнаружить сдвиг LBC с помощью зонда GAGA6, он, хотя и плохо, конкурирует со связыванием LBC с GAGA3 (сравните сдвиг LBC GAGA3 в присутствии 100-кратного избытка GAGA6 со сдвигом в присутствии 100-кратного избытка GAGA6). кратный избыток последовательности Эльбы). Аналогичные результаты были получены, когда GAGA6 конкурировал за связывание LBC с GAGA5 (см. Фиг. S2B в дополнительном материале).

Поскольку LBC связывается с более высокой аффинностью с GAGA3 и GAGA4, чем с GAGA5 (или GAGA6), эти два зонда использовали для генерации серии концевых усечений для дальнейшей локализации последовательности узнавания.Мы ожидали, что этот подход позволит нам сопоставить сайт связывания LBC с меньшей последовательностью ∼20 пар оснований, которую мы затем могли бы далее проанализировать, используя серию замен пар оснований. Однако, как проиллюстрировано на фиг. 5A, LBC требует необычно длинной последовательности ДНК для создания комплекса, достаточно стабильного, чтобы дать сдвиг электрофоретической подвижности. Из концевых усечений, показанных на фиг. 5A, только пробы длиной 65 п.н., GAGA3-65 и GAGA4-65, сохраняют значительную активность связывания LBC. Все более обширные укорочения GAGA3 или GAGA4 в значительной степени отменяют связывание LBC (рис.5А). Фактически, связывание LBC даже с зондами длиной 65 п.н. заметно меньше, чем то, которое наблюдается для зондов с 80 п.н. (фиг. 5A, сравните дорожки 2 и 12 с дорожками 4 и 14). Несмотря на это пониженное сродство, два зонда длиной 65 п.н. напоминают свои более крупные аналоги с размером 80 п.н. Во-первых, LBC, по-видимому, имеет большее сродство к GAGA4-65, чем к GAGA3-65 (сравните дорожки 4 и 14). Во-вторых, два зонда длиной 65 п.н. могут конкурировать друг с другом за связывание LBC. В-третьих, связывание LBC с GAGA3-65 или GAGA4-65 (см. Фиг. S3A и B в дополнительном материале) также может конкурировать с GAGA3, GAGA4 и GAGA5.


Идентификация последовательности связывания LBC. (A) EMSA были выполнены с серией усечений зондов GAGA3 и GAGA4 длиной 80 пар оснований. Для GAGA3 усечения составляли 65, 52 и 40 п.н. в длину. Для GAGA4 усечения составляли 65 п.н., 50 п.н. и 38 п.н. в длину. Мотивы GAGAG в GAGA3 и GAGA4 были мутированы в ACAAA с образованием двух фрагментов длиной 65 п.н., GAGA3-65 GAGAG-mut и GAGA3-65 GAGAG-mut. Каждый субфрагмент инкубировали с ядерными экстрактами поздних (L; 6–18 ч) эмбрионов.(B) EMSA проводили с использованием зонда hsp70-GAGAG, который охватывает ранее охарактеризованную последовательность связывания GAF в промоторе hsp70 (69, 70). Последовательность GAGAG в промоторе hsp70 была мутирована на TCTCT для генерации зонда hsp70-GAGAG-mut. (C) Меченый GAGA3-65 инкубировали с ядерными экстрактами из поздних (от 6 до 18 часов) эмбрионов в отсутствие (дорожки 1 и 2) и в присутствии (дорожки 3–16) немеченого холодного конкурента, как указано над дорожками. К реакционной смеси добавляли 5-, 10-, 50- или 100-кратный избыток холодного конкурента (слева направо, соответственно) из каждого набора.Arrowheads, LBC; F, свободный зонд.

Мотив GAGA необходим, но недостаточен для высокоаффинного связывания LBC. Помимо необычной длины, сравнения последовательностей зондов, которые генерируют стабильные сдвиги электрофоретической подвижности, позволяют предположить, что свойства распознавания LBC должны быть сложными. Единственной общей последовательностью, по-видимому, является мотив связывания GAF (66). Поскольку мотивы GAGA в dHS1 важны для поздней инсуляторной активности в анализах трансгенов, мы проверили, требуется ли для связывания LBC с GAGA3-65 и GAGA4-65 мотив GAGA.На фиг. 5A показано, что мутации в мотиве GAGA3-65 GAGA в значительной степени нарушают связывание LBC, в то время как остаточный сдвиг все еще наблюдается для GAGA4-65 (фиг. 5A). Мутации в мотивах GAGA более крупных зондов, охватывающих GAGA3 и / или GAGA4, также снижают связывание LBC; однако эффекты несколько менее выражены, чем эффекты, наблюдаемые для двух зондов длиной 65 п.о. (данные не показаны).

Поскольку мотив GAGA, по-видимому, важен для связывания LBC с зондами dHS1, мы задались вопросом, достаточно ли его также для генерирования сдвига LBC в поздних ядерных экстрактах.Чтобы исследовать этот вопрос, мы создали зонды, охватывающие три ранее охарактеризованные последовательности связывания GAF в промоторах hsp70 , гистонов h4 и h5 и алкогольдегидрогеназы (67–69). Как проиллюстрировано для зонда из промотора hsp70 на фиг. 5B, эти связывающие последовательности GAF дают сдвиги в поздних ядерных экстрактах, которые мигрируют быстрее, чем сдвиг, генерируемый LBC (и, по-видимому, соответствуют нескольким второстепенным сдвигам, часто наблюдаемым с ГАГА3). Кроме того, последовательность связывания фактора hsp70 GAF не является эффективным конкурентом связывания LBC (рис.2B и 5C; см. также рис. S2 и S3 в дополнительном материале).

Фактор GAGA является компонентом LBC. Хотя наши эксперименты показывают, что мотивы GAGA в GAGA3-65 и GAGA4-65 важны для связывания LBC, ряд результатов может показаться несовместимым с участием GAF. Начнем с того, что минимальная последовательность связывания LBC намного больше, чем необходимая для образования комплекса с помощью GAF. Кроме того, несколько хорошо охарактеризованных связывающих последовательностей GAF дают сдвиги, которые отличаются от LBC и не могут конкурировать за связывание LBC с зондами Fab-7 dHS1.Чтобы устранить эти очевидные несоответствия, мы использовали антитела к GAF в экспериментах с суперсдвигом. Мы также протестировали Pipsqueak (Psq), который, как и GAF, распознает мотив GAGA (70, 71). Мы обнаружили, что антитела к Psq не могут вызывать сверхсдвиг или блокировать связывание LBC (данные не показаны). Напротив, сдвиги GAGA3, GAGA4 и GAGA5 LBC могут быть все суперсмещены с помощью поликлонального антитела к GAF крысы (фиг. 6A). Суперсдвиги LBC, по-видимому, не являются аномалией этого конкретного антитела GAF, поскольку аналогичные результаты были получены при использовании двух других независимых кроличьих поликлональных антител GAF (данные не показаны).


LBC представляет собой комплекс массой 700 кДа, который содержит фактор GAGA (GAF). (A) Зонды GAGA3, GAGA4, GAGA5 и GAGA6 из Fab-7 инкубировали с поздними ядерными экстрактами, без или с контрольной сывороткой крыс (RS) (дорожки 3, 7, 11 и 15) или крысиные поликлональные антитела против GAF (α-GAF) (дорожки 4, 8, 13 и 15). Указаны суперсдвиги антител (SS). (B) EMSA с использованием зонда GAGA4, инкубированного с фракциями колонки, полученными из ядерных экстрактов поздней стадии, фракционированных с помощью эксклюзионной хроматографии.EMSA с использованием GAGA3 использовали для обнаружения LBC во фракциях колонки. Образцы, используемые в дорожках с 1 по 28, инкубировали с 10 мкл соответствующих фракций колонки плюс крысиная сыворотка. 6-18-часовые ядерные экстракты (NE) использовали в качестве входных данных (полоса 30). Размеры маркеров молекулярной массы, используемых в качестве стандартов, указаны над соответствующими фракциями колонки. Arrowheads, LBC; F, свободный зонд (см. Также рис. S3 в дополнительном материале).

Мультибелковый комплекс ∼700 кДа составляет фактор поздней стадии инсулятора.Результаты, описанные в предыдущих разделах, показывают, что GAF является важным компонентом LBC; однако известные свойства этого белка не учитывают необычно длинные и кажущиеся сложными последовательности, которые требуются для генерации LBC-сдвига. Одним из объяснений новых свойств распознавания последовательностей LBC является то, что это комплекс нескольких белков, включая GAF. Потенциально этот комплекс может быть собран, возможно, поэтапно, на зондах LBC во время инкубации с ядерными экстрактами.Альтернативно, комплекс может существовать в экстракте предварительно собранным, и в этом случае он будет связываться с ДНК как комплекс. Чтобы различить эти возможности, мы фракционировали поздние ядерные экстракты с помощью эксклюзионной хроматографии, а затем протестировали фракции на активность LBC с использованием зонда GAGA4. Активность LBC была обнаружена во фракциях с 8 по 12, что соответствует комплексу порядка ~ 700 кДа (фиг. 6B; см. Также фиг. S4 в дополнительном материале).

LBC имеет компоненты в дополнение к GAF.Тот факт, что LBC существует как предварительно собранный комплекс в ядерных экстрактах и ​​проявляет свойства связывания ДНК, которые существенно отличаются от свойств одного только GAF, предполагает, что этот комплекс должен содержать дополнительные виды белков. Чтобы изучить эту возможность, мы использовали антитела, направленные против известных инсуляторных белков, для экспериментов с суперсдвигом. Тестируемые антитела включали BEAF, CP190, Elba, Enhancer of yellow 2 [E (y) 2], Insensitive (Insv), Lola-like, Mod (mdg4), Su (Hw) и Pita (11, 14, 24, 33, 35, 57, 72–82).Подобно GAF (и Pipsqueak), CP190 и Lola-like имеют N-концевые домены взаимодействия белок-белок BTB и несколько C-концевых цинковых пальцев, которые опосредуют связывание ДНК. Mod (mdg4) также имеет N-концевой домен BTB; однако С-концевая половина белка сильно варьирует из-за сложной структуры альтернативного сплайсинга. Комплекс Elba и Insv связывают ДНК через консервативные домены BEN, в то время как белок Pita имеет домен ZAD и связывает ДНК через 10 C 2 H 2 цинковых пальцев (79, 83).Есть две изоформы BEAF, которые имеют разные N-концевые ДНК-связывающие домены, но совместно используют C-концевой домен взаимодействия. Наконец, E (y) 2 представляет собой небольшой белок из 101 аминокислоты, который широко консервативен. В случае BEAF, CP190, Elba, Insv, Lola-like и Pita мы не наблюдали сверхсдвига LBC, а также не было очевидного снижения выхода сдвига LBC (данные не показаны). С учетом того, что эпитопы, распознаваемые антителами, могут быть скрыты в комплексе, оказалось, что эти шесть белков не являются частью LBC.С другой стороны, как показано на фиг. 7, антитела как Mod (mdg4), так и E (y) 2 генерировали суперсдвиг LBC. Эти данные предполагают, что в дополнение к GAF, Mod (mdg4) и E (y) 2 являются компонентами LBC ∼700 кДа.


Mod (mdg4) и E (y) 2 также являются компонентами LBC. Зонд GAGA4 инкубировали с поздними ядерными экстрактами, без и с контрольной предиммунной кроличьей сывороткой (RabS) (дорожка 3), предиммунной крысиной сывороткой (дорожка 4), крысиными поликлональными антителами против GAF (дорожка 5), поликлональными кроличьими антителами. антитело против Mod (mdg4) (полоса 6) или крысиное поликлональное антитело против E (y) 2 (усилитель желтого 2) (полоса 7).

Fab-7 мотивов GAGA необходимы для полной инсуляторной активности. Трансгенные анализы показали, что мутации в мотивах GAGA3 и GAGA4 влияют на энхансер-блокирующую активность Fab-7 во время мидэмбриогенеза и у взрослых (56). Описанные выше эксперименты предполагают, что это снижение активности позднего блокирования, вероятно, связано с нарушением связывания LBC. Для дальнейшего изучения этой возможности мы использовали интеграционную платформу Fab-7 attP50 , чтобы проверить, важны ли мотивы GAGA в элементах распознавания LBC для активности инсулятора Fab-7 в контексте BX-C. .Для этих экспериментов мы ввели мутации мотива GAGA во фрагмент Fab-7 , охватывающий *, HS1 и HS2 (который также включает HS3 iab-7 PRE). Помимо мутации трех мотивов GAGA, участвующих (прямо, как с GAGA3 и GAGA4, или косвенно, как с GAGA5) в связывании LBC, мы также мутировали два других мотива GAGA в последовательности dHS1. Один из них — GAGA6. Хотя сдвиг LBC не наблюдается с зондом GAGA6, эксперименты по конкуренции показали, что LBC, тем не менее, может связываться, хотя и слабо, с этой областью dHS1.Другой — это эволюционно консервативная последовательность узнавания GAF с более низким сродством, GAGAA, расположенная на девять нуклеотидов дистальнее GAGA4. Наконец, чтобы гарантировать, что фенотипические эффекты мутаций в мотивах dHS1 GAGA не маскируются граничной активностью субэлемента pHS1, мы мутировали две связывающие последовательности GAF в pHS1, которые, как известно, важны для пограничной активности pHS1 в анализах трансгена, плюс сайт с низким сродством на проксимальном конце pHS1 (56).

Фенотипические эффекты мутаций мотива GAGA на граничную активность Fab-7 в BX-C повторяют те, которые наблюдались при удалении всей последовательности HS1 (сравните фиг.2F и G). Подобно мухам Fab-7 ΔHS1 , Fab-7 GAGA1-6 мух имеют смешанный фенотип GOF / LOF в PS11 / A6. Как и ожидалось, когда iab-7 эктопически активируется в клетках PS11, только остаточный шестой тергит и стернит остаются у Fab-7 GAGA1-6 самцов. Небольшой участок ткани тергита «A6» (белый кружок) покрыт трихомами, что означает, что выжившие клетки имеют идентичность PS10 (A5), а не PS11 (A6). Точно так же остаточный стернит (черный кружок) имеет щетину и, следовательно, имеет идентичность PS10.Помимо демонстрации того, что мотивы GAGA в HS1 важны для граничной активности, тот факт, что мутации, которые нарушают связывание LBC с его элементами распознавания в dHS1 in vitro , нарушают граничную функцию in vivo , свидетельствует о том, что LBC является критическим компонентом изолятор Fab-7 .


Мы использовали эксперименты по замене границ, чтобы идентифицировать последовательности в Fab-7 , которые необходимы для его граничных функций в контексте BX-C.Мы показываем, что гиперчувствительный к нуклеазе HS1 участок необходим для функции Fab-7 . Напротив, гиперчувствительные к нуклеазе области HS2, а также * (48) не являются существенными. Более того, хотя известно, что эти последовательности вносят вклад в активность инсулятора Fab-7 и в анализах трансгена (53), они, по-видимому, несут незаменимую активность в контексте BX-C, поскольку одной последовательности HS1 достаточно для полной функции.

Как анализ трансгена, так и частичные делеции Fab-7 (39, 56) показывают, что HS1 состоит из субэлементов, граничная активность которых ограничена в процессе развития.Субэлементы в проксимальной половине HS1 (pHS1) придают инсуляторную активность во время раннего развития, тогда как субэлементы в дистальной половине (dHS1) функционируют (по большей части) от мидэмбриогенеза до взрослой стадии. Ранее мы показали, что ранняя инсуляторная активность субэлемента pHS1 обеспечивается, по крайней мере частично, гетеротримерным комплексом Elba. Здесь мы идентифицировали новый белковый комплекс, LBC, который связывается с субэлементами в dHS1, которые обладают инсуляторной активностью у поздних эмбрионов и у взрослых мух.Хотя убедительная демонстрация того, что LBC отвечает за позднюю инсуляторную активность Fab-7 , потребует идентификации всех белковых компонентов этого комплекса, несколько линий доказательств убедительно подтверждают правильность этого предположения. Первый — это профиль развития. LBC обогащен ядерными экстрактами, приготовленными из поздних 6–18-часовых эмбрионов, в то время как в экстрактах ранних 0–6-часовых эмбрионов обнаруживается лишь небольшая активность LBC. Во-вторых, LBC связывается с множеством распознающих элементов в области dHS1 HS1.Эта область HS1, как известно, отвечает за активность инсулятора конца Fab-7 как в тестах BX-C, так и в анализах трансгена (39, 56). Более того, характер связывания LBC с его элементами распознавания в dHS1 соответствует активности блокирования энхансера мультимеризованных субфрагментов dHS1, dHS1A и dHS1B. dHS1A, который охватывает два элемента LBC с более высоким сродством, GAGA3 и GAGA4, обладает более сильной поздней блокирующей активностью, чем полноразмерный Fab-7 , в то время как dHS1B, который содержит два элемента распознавания LBC с более низким сродством, GAGA5 и GAGA6, имеет только умеренную или слабую позднюю блокирующую активность.В-третьих, мы обнаружили, что связывание LBC с узнающими элементами в dHS1 требует мотива GAGA. В соответствии с критической ролью LBC в активности инсулятора, когда мутации в мотивах dHS1 GAGA сочетаются с мутациями в мотивах GAGA в pHS1, которые необходимы для ранней инсуляторной активности, граничная функция Fab-7 в BX-C отменяется. . Дальнейшая связь между LBC и активностью позднего инсулятора заключается в том, что мутации в мотивах LBC GAGA GAGA3 и GAGA4 ослабляют активность позднего инсулятора в анализах трансгена (56).В-четвертых, как можно было ожидать, исходя из эффектов мутаций мотива GAGA на связывание ДНК in vitro и инсуляторную функцию in vivo , одним из белковых компонентов LBC является фактор GAGA, GAF. Эксперименты с ChIP показывают, что GAF ассоциирован с последовательностями Fab-7 HS1 in vivo (25, 26). Хотя есть предостережение, что антитело к GAF не различает GAF в комплексе LBC и массу GAF, тем не менее, это согласуется с представлением о том, что LBC связывается с инсулятором Fab-7 in vivo .Участие GAF также согласуется с другими экспериментами, в которых этот белок участвует в пограничной активности Fab-7 (56, 84, 85). Однако ранее считалось, что основная функция GAF заключается в создании области, свободной от нуклеосом, которая позволяет связывать белки, которые функционируют как инсуляторы. Тот факт, что GAF является компонентом LBC, предполагает, что он, вероятно, имеет гораздо более тесную связь с активностью инсулятора, чем предполагалось ранее. В-пятых, еще одним подтверждением функциональной связи между LBC и активностью поздних границ является тот факт, что два других белка, участвующих в функции инсулятора, Mod (mdg4) и E (y) 2, также, по-видимому, являются компонентами LBC.Более того, ChIP показывают, что Mod (mdg4), как и GAF, ассоциирован с последовательностями Fab-7 HS1 in vivo (25). Поскольку GAF и Mod (mdg4) часто совместно локализуются на других известных или предсказанных границах в другом месте генома, LBC, вероятно, будет важен для функции инсулятора в более глобальном масштабе.

Хотя наша характеристика LBC является неполной, то, что мы действительно знаем, предполагает, что это увлекательный комплекс. Помимо того, что он имеет удивительно большую минимальную связывающую последовательность ~ 65 п.н., его свойства распознавания последовательности ДНК необычайно гибки.Сравнение трех элементов узнавания LBC в dHS1 не выявляет очевидного сходства последовательностей, кроме того факта, что они имеют общий мотив GAGA (плюс предшествующую последовательность AA). В неопубликованных экспериментах мы идентифицировали несколько элементов распознавания LBC (по EMSA) в границах Fab-7 от трех других видов дрозофилы, D. yakuba, D. erecta и D. pseudoobscura. Как и у D. melanogaster, элементы распознавания LBC на каждой из этих границ отличаются от таковых у их соседей.Более того, хотя элементы распознавания в двух видах группы D. melanogaster, D. yakuba и D. erecta , демонстрируют высокую степень сходства последовательностей с соответствующими элементами в D. melanogaster, последовательности D. pseudoobscura элементы узнавания имеют мало общего с таковыми у видов группы D. melanogaster. В то время как мутации в мотивах GAGA GAGA3 и GAGA4 в значительной степени нарушают связывание с зондами, охватывающими сайты GAGA3 и GAGA4, присутствие мотива GAGA в других контекстах недостаточно для связывания LBC.LBC не сдвигает хорошо охарактеризованные связывающие последовательности для GAF в промоторах нескольких генов мух, даже если эти последовательности связаны с GAF в ядерных экстрактах. Помимо того, что он недостаточен для стабильного связывания, мы обнаружили, что мотив GAGA не всегда необходим для связывания LBC. Границы Fab-7 из D. erecta и D. yakuba имеют четыре, а не три элемента распознавания LBC. В обоих случаях один из четырех элементов лишен мотива GAGA (D. Wolle, неопубликованные данные).Дополнительное доказательство того, что свойства распознавания последовательности LBC необычны, получены из экспериментов по мутагенезу с GAGA3-65 и GAGA4-65. В то время как мутации мотивов GAGA ослабляли связывание LBC, мутации (замены 12 п.н.) в другом месте в двух пробах имели минимальный эффект.

Эксперименты по гель-фильтрации показывают, что LBC не собирается поэтапно на ДНК, а скорее существует как предварительно собранный комплекс 700 кДа. Наши эксперименты со сверхсдвигом показывают, что в этом комплексе есть три разных белка: GAF, Mod (mdg4) и E (y) 2.Однако, поскольку мы смогли протестировать только известные инсуляторные белки, в комплексе могли быть и другие неидентифицированные или неизвестные белки. Кроме того, поскольку сдвиг LBC состоит из нескольких поддиапазонов, выход которых варьируется в зависимости от зонда, могут быть дополнительные факторы, которые стабильно связываются с комплексом только тогда, когда LBC связывается с определенным элементом.

У мухи есть две изоформы белка GAF, GAF519 и GAF581. Они имеют общий N-концевой домен BTB и единственный внутренний C 2 H 2 цинковый палец, но имеют отдельный C-концевой домен.Цинковый палец отвечает за связывание ДНК, в то время как N-концевой домен BTB функционирует во взаимодействиях белок-белок. Поскольку домены GAF BTB собираются в димеры, тетрамеры и октомеры, кажется вероятным, что LBC содержит два, если не больше, белков GAF (66). Хотя это не объясняет, почему минимальный элемент распознавания имеет длину по крайней мере 65 п.н., это повышает вероятность того, что LBC может одновременно взаимодействовать с несколькими мотивами GAGA. В этом отношении следует отметить, что каждый из распознающих элементов в dHS1 имеет единственный мотив GAGA.Хотя мы обнаружили, что LBC независимо связывается с каждым элементом, наши эксперименты не исключают возможность того, что он связывается одновременно с двумя или более элементами. Если это так, LBC потенциально может взаимодействовать с несколькими мотивами GAGAG, распределенными по последовательности, простирающейся от 120 до 200 п.н. Однако для этого, вероятно, потребуется, чтобы ДНК обернулась вокруг внешней поверхности комплекса, как в нуклеосоме. Размер комплекса примерно в шесть раз превышает массу нуклеосомы, поэтому размер комплекса должен быть более чем достаточным для размещения последовательности ДНК такой длины.Более того, существуют прецеденты для наматывания расширенных последовательностей узнавания на большие регуляторные комплексы. Например, PRE мух (которые, как и инсуляторы, охватывают большие [> 200 п.н.] гиперчувствительные к нуклеазе области), по-видимому, собираются путем наматывания последовательности PRE вокруг большого комплекса, содержащего связывание ДНК и белки группы Polycomb (86).

Как и GAF, Mod (mdg4) имеет N-концевой домен BTB, который может самособираться; однако, в отличие от GAF, где наиболее стабильным комплексом, по-видимому, является димер, первичный мультимер Mod (mdg4) считается октамером (87).Таким образом, белок Mod (mdg4) может быть одним из наиболее распространенных компонентов LBC. Если это верно, то он может играть роль скаффолдинга в комплексе, поскольку домены Mod (mdg4) и GAF BTB взаимодействуют не только сами с собой, но и друг с другом (82). Хотя домен BTB является общим для всех изоформ Mod (mdg4), существует 31 различный C-концевой домен. Предполагается, что двадцать девять из этих изоформ обладают ДНК-связывающей активностью. Из них одна изоформа имеет домен цинкового пальца BED, такой как ДНК-связывающий домен в инсуляторном белке BEAF, а другая, такая как инсуляторные белки Elba1, Elba2 и Insv, имеет ДНК-связывающий домен BEN.Две из этих изоформ имеют С-концевые последовательности, которые не проявляют гомологии с известными ДНК-связывающими доменами. Остальные 27 изоформ Mod (mdg4) имеют домен пальца Zn типа FLYWCH. Хотя связывание ДНК изоформ Mod (mdg4), содержащих один из этих пальцев FLYWCH Zn, еще не было продемонстрировано, было показано, что белок PEB-1 Caenorhabditis elegans связывает ДНК через свой домен FLYWCH (80). Таким образом, разумно ожидать, что белок (ы) Mod (mdg4) в LBC, вероятно, будет способствовать связыванию ДНК. Поскольку известные взаимодействия Mod (mdg4) -GAF опосредуются общим доменом BTB, возможно, что LBC, который мы обнаруживаем у 6-18-часовых эмбрионов, содержит смесь нескольких различных белков Mod (mdg4) (которые могут даже варьироваться в зависимости от альтернативных паттернов сплайсинга, которые преобладают в типах клеток или тканей, из которых происходит комплекс).Если в LBC присутствует несколько изоформ Mod (mdg4), это может объяснить его необычно гибкие свойства распознавания последовательности. Альтернативно, вариабельные домены в одной или нескольких изоформ могут содержать сигналы, которые опосредуют предпочтительное включение изоформы (ов) в LBC. Решение этой проблемы, а также возможной роли белка (ов) Mod (mdg4) в качестве каркасного фактора и / или в определении специфичности последовательности потребует очистки комплекса.

Третий компонент LBC — E (y) 2.Было показано, что этот небольшой консервативный белок взаимодействует с общим фактором транскрипции TFIID у мух, в то время как его аналог Saccharomyces cerevisiae, Sus1, является компонентом комплекса SAGA (88, 89). Было показано, что помимо функционирования с аппаратом транскрипции, E (y) 2 взаимодействует с инсуляторным белком Su (Hw). Хотя E (y) 2 не требуется для энхансер-блокирующей активности инсуляторов Su (Hw), он необходим для блокирования сайленсинга, индуцированного элементами ответа Polycomb (PRE).Поскольку одной из важных функций Fab-7 , а также других изоляторов в BX-C является предотвращение отключения PRE в заглушенных cis -регуляторных доменах своих активных соседей, было бы разумно предположить, что E (y) 2 играет аналогичную роль в LBC. Фактически, именно это происходит с мутантами ΔHS1 и GAGA 1–6 : PRE в iab-7 ненадлежащим образом подавляет цис-регулирующий домен iab-6 в подмножестве клеток PS11.

Помимо необычных свойств распознавания последовательностей LBC, другой отличительной особенностью LBC является то, что его активность ограничена в связи с развитием. Он обогащен ядерными экстрактами, приготовленными из поздних эмбрионов, в то время как в экстрактах ранних эмбрионов он присутствует только в небольших количествах. Фактор Эльбы — единственный другой известный регулируемый в процессе развития инсуляторный комплекс, и его активность ограничена ранними эмбрионами, потому что две субъединицы Эльбы, Эльба1 и Эльба3, являются генами перехода в среднюю бластулу (57, 58).Возможно, подобный механизм может объяснить позднее проявление активности LBC в ядерных экстрактах. Одним из потенциальных кандидатов может быть изоформа GAF GAF581. В отличие от GAF519, чье сообщение депонируется от матери, экспрессия GAF581 начинается примерно через 6 часов (90). Хотя отсроченная экспрессия изоформы GAF581 хорошо согласуется с профилем развития LBC, функциональные исследования утверждают, что если существует LBC-специфическая изоформа, то это будет GAF519, а не GAF581 (91). Поскольку две изоформы GAF подвержены посттрансляционным модификациям, специфичным для каждой стадии, альтернативная возможность состоит в том, что модификация играет критическую роль в сборке LBC и включении белка GAF.Конечно, другие компоненты компонентов LBC могут нести ответственность за специфичность его стадии. Одной из возможностей могла бы быть экспрессия специфических изоформ Mod (mdg4), которые необходимы для каркаса сборки комплекса LBC. Также может существовать пока не идентифицированный специфичный для стадии белок (белки), который необходим для образования комплекса. Дальнейшие исследования должны разрешить этот вопрос.


Мы благодарим Роберта Маэда и Хенрика Гюрковичса за содержательные обсуждения. Мы также благодарим Еву Фавр, Бенджамина Барандана, Хорхе Фаустино и Гордона Грея за отличную техническую помощь.Мы благодарим Антона Головнина, Павла Георгиева, Элиссу Лей, Виктора Корееса, Карла Ву и Дэвида Гилмора за дар антител. Мы также благодарим рецензентов за их вдумчивые комментарии.

F.K. благодарит за поддержку грантами Фонда пожертвований Клараза, штата Женева и Швейцарского национального фонда исследований. P.S. благодарит за поддержку грант NIH (GM043432) и грант Института биологии гена Министерства образования и науки Российской Федерации (14.B25.31.0022).

  • Copyright © 2015, Американское общество микробиологии. Все права защищены.

Этот сайт использует файлы cookie для повышения производительности. Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.

Настройка вашего браузера для приема файлов cookie

Существует множество причин, по которым cookie не может быть установлен правильно. Ниже приведены наиболее частые причины:

  • В вашем браузере отключены файлы cookie.Вам необходимо сбросить настройки своего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
  • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались. Чтобы принять файлы cookie с этого сайта, используйте кнопку «Назад» и примите файлы cookie.
  • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
  • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie.Чтобы исправить это, установите правильное время и дату на своем компьютере.
  • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie. Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

Почему этому сайту требуются файлы cookie?

Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.

Что сохраняется в файле cookie?

Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

Как правило, в файлах cookie может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

Сборная России по футболу прошла неожиданный тест на мельдоний

МЕКСИКА — В четверг без предупреждения прибыли испытатели наркотиков ФИФА для сбора образцов у российской футбольной команды ФК «Ростов» на фоне подозрений в использовании мельдония во время внезапной погони за чемпионским титулом.

Ростовская команда прошла испытание после победы над «Динамо» (Москва) со счетом 3: 1, чтобы переместиться на два очка от лидера лиги ЦСКА за две оставшиеся игры, сообщил Associated Press главный врач ФИФА Иржи Дворжак.

«Ростов» остался в высшем дивизионе России только после прошлогоднего плей-офф на вылет и неожиданно участвовал в чемпионской гонке в этом сезоне. Дворжак сказал, что Ростов, который принадлежит региональному правительству на юге России, «полностью» соблюдает требования его группы по тестированию на наркотики.

«Мы протестировали всю команду, те 11 человек, которые были в стартовом списке», — сказал Дворжак AP на Конгрессе ФИФА в Мехико вскоре после завершения тестов в столице России.«Вся процедура заняла два часа. Она сделана, и образцы будут протестированы в одной из аккредитованных лабораторий в Европе».

Мельдоний был запрещен с 1 января Всемирным антидопинговым агентством. После того, как препарат был запрещен, в различных видах спорта и странах было проведено более 170 неудачных тестов, многие из которых были в России.

Препарат латвийского производства, который обычно назначают при сердечных заболеваниях, широко использовался в качестве добавки спортсменами в странах Восточной Европы.Препарат увеличивает кровоток, что улучшает переносимость упражнений, доставляя больше кислорода к мышцам.

«В СМИ ходили слухи о том, что мельдоний и Ростов заказали мельдоний», — сказал Дворжак. «Что это правда, я действительно ничего не могу сказать … мы на самом деле не следим за всеми слухами, но (учитывая) текущую ситуацию с мельдонием, мы думали, что это просто хороший пример, чтобы сделать это».

Самый громкий случай касается Марии Шараповой, которая объявила, что у нее положительный результат во время Открытого чемпионата Австралии в январе.

Семь из 11 игроков «Ростова» в четверг родились в России.

Состав команды, согласно веб-сайту ФИФА, был следующим: Сослан Джанаев (Россия), Дмитрий Полоз (Россия), Бастос (Ангола), Кристиан Нобоа (Эквадор), Павел Могилевец (Россия), Сардар Азмун (Иран), Иван Новосельцев ( Россия), Борис Ротенберг (Россия-Финляндия), Федор Кудряшов (Россия), Цезарь Навас (Испания), Александр Ерохин (Россия).

Помощник тренера Ростова Виталий Кафанов заявил российской газете «Спорт-экспресс», что не «верит в то, что ребята принимали запрещенные вещества».«

«У нас нет денег даже на простое лекарство», — сказал Кафанов, имея в виду недавние финансовые проблемы клуба.

У ФИФА не впервые возникают подозрения в отношении российской футбольной команды. По словам Дворжака, перед чемпионатом мира 2014 года сборную России тайно проверили на предмет вдыхания ксенона. Не было обнаружено ни одного игрока, употребляющего вещество, которое было запрещено ВАДА только позднее в 2014 году.

Дворжак провел проверку на ксенон после того, как услышал слухи, что российские спортсмены на Олимпийских играх в Сочи в 2014 году использовали газ, который, как утверждается, искусственно увеличивает уровень эритропоэтина (ЭПО) в крови.

«Мы используем наш мозг. Мы проводим тестирование интеллекта», — сказал Дворжак. «Меня больше интересовало, используется ли это вещество (ксенон) на регулярной основе. Я не объявлял об этом (в Россию). Я просто спросил лабораторию:« Можете ли вы проверить это »».

Павел Витрук | Боевые новости без ограничений

НАЗРАН, Ингушетия, Россия (23 апреля 2017 г.) — Непобежденный Мовсар Евлоев завоевал титул чемпиона в легчайшем весе Interim M-1 Challenge на вчерашнем главном событии M-1 Challenge 76 в Назрани, Ингушетия, Россия.

Евлоев улучшил свой профессиональный рекорд в ММА до 7-0-0, все в соревнованиях M-1 Challenge, нокаутировав россиянина Алексея Невзорова (12-3-0, М-1: 6-2-0) во втором. круглый.

Евлоев, проигравший американцу Ли Моррисон впечатляющим решением в трех раундах, воспользовался возможностью побороться за временный титул из-за длительной травмы действующего чемпиона M-1 Challenge в легчайшем весе Павла Витрука. .

Судьи были заняты, поскольку семь из девяти других боев на карте M-1 Challenge 76 прошли всю дистанцию.На этой высококонкурентной карте бойцы представляли шесть разных стран.

Россиянин в полулегком весе Тимур Нагибин (9-2-0, М-1: 5-1-0) и казахстанский легчайший вес Сергей Морозов (7-2-0, М-1: 4-2-0) были оба победители по результатам трех раундов единогласным решением судей, соответственно, над своими бразильскими оппонентами Диего Давелла (18-6-0, М-1: 1-1-0) и Фабрицио «Билл» Саррафф (22-10- 0 (М-1: 0-1-0)

Немецкий полутяжелый вес Рене Хоппе (7-0-0, М-1: 2-0-0) увеличил свою беспроигрышную серию до семи подряд, победив решением большинства судей в трех раундах над ранее непобежденным Ике Бочков ( 2-1-0, М-1: 0-1-0), России.

Российский полутяжелый вес Абубакар Местоев улучшился до 5-0-0 с его пятой победой подряд в общем зачете и в соревнованиях M-1 Challenge с трехраундовой победой над украинцем Анатолий Лягу (5-2-0, M-1 : 0-1-0).

Россиянин в легчайшем весе Эмиль Абасов (6-7-0, М-1: 3-0-0), который заменил себя на взвешивании из-за того, что исходный противник был слишком толстым, завершил беспорядок ночи первым ударом. раунд техническим нокаутом (удары руками) против Хелитон Давелла (15-6-0, М-1: 0-1-0) из Бразилии.

Бой в предварительной карточке, россиянин Залимбег Омаров (8-2-1, М-1: 5-1-1), российский полусредний вес Хамзат Сакалов (6-1-0, М-1: 5-0-0 ) и российский супертяжеловес Евгений Гиончаров (6-3-0, М-1: 1-0-0) стали победителями по результатам трех раундов соответственно против украинца Эльнура Валиева (6-1-1, М -1: 0-1-0), испанец Хавьер Фуэтас (9-5-0, М-1: 2-2-0) и россиянин Даниил Арепьев (7-2-0, М-1: 0 -2-0).

Российский полусредний вес Ингишхан Оздоев (3-3-0, М-1 3-3-0) остановил Алексей Валивахин (8-6-0, М-1: 0-1-0) на ударах во втором. круглый.

Полные результаты и фотогалерея ниже:



Мовсар Евлоев (7-0-0, М-1: 7-0-0), Россия

WKO2 (Удар головой — 2:15)

Алексей Невзоров (12-3-0, М-1: 6-2-0), Россия

(Евлоев выиграл промежуточный титул чемпиона M-1 Challenge в легчайшем весе)


Рене Хоппе (7-0-0, М-1: 2-0-0), Германия


Ике Бочков (2-1-0, М-1: 1-0-0), Россия


Тимур Нагибин (9-2-0, М-1: 5-1-0), Россия


Диего Давелла (18-6-0, М-1: 1-1-0,) Бразилия

Эмиль Абасов (6-7-0, М-1: 3-0-0), Россия

WTKO1 (Удары — (2:39)

Хелитон Давелла (18-5-0, М-1: 1-0-0), Бразилия


Сергей Морозов (7-2-0, М-1: 4-2-0), Казахстан


Фабрицио Сарраф (22-10-0, М-1: 0-0-0), Бразилия



Евгений Гончаров (6-3-0, М-1: 1-0-0), Россия


Даниил Арепьев (7-2-0, М-1: 0-2-0,), Россия


Хамзат Сакалов (6-1-0, М-1: 5-0-0), Россия


Хавьер Фуэнтас (9-5-0, М-1: 2-2-0), Испания

Ингисхан Оздоев (3-3-0, М-1: 3-3-0), Россия

WTKO1 (Удары — 3:22)

Алексей Валивахин (8-6-0, М-1: 0-1-0), Украина


Залимбег Омаров (8-2-1, М-1: 5-1-0), Россия


Эльнур Валиев (6-1-1, М-1: 0-1-0), Украина


Абубакар Местоев (5-0-0, М-1: 5-0-0)


Анатолий Лягу (5-2-0, М-1: 0-1-0), Украина

Twitter и Instagram:

@ M1GlobalNews


@ M1Global



M-1 Challenge 77: Немков vs.Markes — 19 мая 2017 г. Сочи, Россия

M-1 Challenge 78: Дивнич против Исмагулова — 26 мая 2017 г. в Оренбурге, Россия

M-1 Challenge 79: Шлеменко против Хэлси — 1 июня 2017 г., Санкт-Петербург, Россия

M-1 Challenge 80: Харитонов vs / Лопес — 15 июня 2017 г. в Хабине, Китай

Заключительный отчет об убийствах Орхана Джемаля, Александра Растогруева и Кирилла Радченко в Центральноафриканской Республике

Из меморандума, подписанного представителями Российской Федерации аффилированных с Евгением Пригожиным и членами правительства ЦАР, который недавно стал доступен Центру досье, следует, что защита президента ЦАР была одним из приоритетных направлений сотрудничества, обозначенных на встрече в Сочи, 7 октября 2017 г .: «Российская сторона также считает необходимым провести предварительный отбор и повышение квалификации членов группы личной безопасности Президента Центральноафриканской Республики. В связи с вышеизложенным Российская Федерация готова поставить бронированный автомобиль и современное охранное оборудование, а также направить группу экспертов для организации личной охраны президента Центральноафриканской Республики ». Другое соглашение между российской стороной и правительством ЦАР, как указано в документе, касалось «создания условий для защиты путем обеспечения свободного прохода через Судан» : «В ходе обсуждения стороны пришли к соглашению, что Присутствие вооруженных иностранных специалистов может быть оправдано в этом контексте необходимостью защиты территорий разработки месторождений полезных ископаемых. Эти специалисты могли быть замаскированы под сотрудников суданской охранной фирмы ». Для выполнения этой задачи стороны решили создать секретный военный учебный центр на аэродроме Уадда: «Центральноафриканская сторона признала необходимость создания учебного центра для членов Национальной гвардии, которые являются гражданами Центральноафриканской Республики. ».

Раздел 2.5 документа «Вопросы взаимодействия с ООН и МИНУСКА, включая размещение вооруженных сил и их легализацию на территории ЦАР» заслуживает особого внимания.В нем говорится, что в соответствии с резолюцией Совета Безопасности ООН № 2127 от 5 декабря 2013 года развертывание вооруженных сил и их использование в целях защиты и безопасности возможно только по запросу президента ЦАР с санкции Совета Безопасности ООН. Центральноафриканская сторона отметила, что на практике получение такого разрешения может занять до трех месяцев, но она «не видит препятствий, которые могли бы помешать созданию подразделения безопасности президента до получения необходимого разрешения.Если ООН и МИНУСКА поднимут какие-либо вопросы в связи с этой ситуацией, правительство Центральноафриканской Республики предоставит обоснование присутствию российских военнослужащих ».

После переговоров между Министром иностранных дел Российской Федерации Сергеем Лавровым и Президентом Центральноафриканской Республики Фостен-Арканж Туадера (Сочи, 9 октября 2017 г.) Россия обратилась к Совету Безопасности ООН с просьбой предоставить исключение из ЦАР. эмбарго на поставки оружия, позволяющее передать правительству ЦАР военную технику и начать программу обучения местного военного персонала.В декабре ООН предоставила России разрешение на поставку первой партии оружия в ЦАР. 26 декабря 2017 года Комитет Совета Безопасности ООН получил уведомление от Российской Федерации об обучении сил обороны и безопасности Центральной Африки 5 военными и 170 гражданскими российскими инструкторами сроком на один год.

Первая тренировка для сотрудников национальной обороны и безопасности ЦАР, проведенная военными (5) и гражданскими (170) российскими инструкторами, как было уведомлено Комитетом 26 декабря 2017 года, завершилась 31 марта 2018 года.Тренировки проходили на территории ЦАР и Судана. С апреля 2018 года российские инструкторы также приступили к обучению 160 полицейских и 50 жандармов на военной базе в Беренго. Также известно, что договор между ЦАР и Россией предусматривал поставку гранатометов, пулеметов и пистолетов, а также обучение двух батальонов (1300 человек) использованию этого оружия. Из внутренней презентации, подготовленной сотрудниками Пригожина, следует, что по состоянию на 7 октября 2018 года российские инструкторы обучили 1227 солдат FACA.

К декабрю 2018 года российские инструкторы также обучили 102 полицейских и 117 жандармов на военной базе в Беренго. Известно, что российские инструкторы дислоцируются в городах Бамбари, Бангасу, Банги, Беренго, Буар, Декоа, Пауа и Сибут.

В период с 26 января 2018 г. по 7 февраля 2018 г. девять самолетов прибыли в международный аэропорт Банги М’Поко для доставки оружия и боеприпасов в рамках военного сотрудничества между правительствами Российской Федерации и Центральноафриканской Республики.Согласно меморандуму от 6 февраля 2018 г., подготовленному послом Франции в ЦАР Кристианом Бадером (копия которого имеется в Центре досье), самолеты были выгружены россиянами, как правило, ночью, в присутствии Тренингов ЕС. Представители миссии (в то время как представители ЮНМАС, должным образом уполномоченные Управлением специального посланника ООН, явно отсутствовали), после чего груз был доставлен в Камп-де-Ру, который не был должным образом оборудован для хранения оружия и боеприпасов (см. Приложения B27a, B27b).В меморандуме также выражается озабоченность в связи с отсутствием контроля над поставками: «Несмотря на то, что Россия утверждает, что ее действия« полностью прозрачны », в настоящее время нет достоверной информации о количестве поставленных вооружений или планах их последующего использования. развертывание ». Более того, в служебной записке отмечалось, что первые 22 российских инструктора, прибывших в декабре 2017 года, могли использовать поддельные паспорта. По данным посольства Франции, несколько десятков граждан России, прибывших в ЦАР, обычно приезжали небольшими группами, в некоторые из которых входили представители частных компаний.Беренго был обозначен как основной район дислокации российских граждан за пределами Банги. Около 15 граждан России (сотрудники Sewa Security) уже находились на месте, готовя инфраструктуру, необходимую для обучения военнослужащих ЦАР; Первая группа солдат ЦАР (200 человек) была отправлена ​​на обучение в Судан, в частности, на военную базу к северу от Хартума. В меморандуме посольства Франции содержится следующий вывод: «Поставки оружия правительству ЦАР все больше выглядят как« входной билет »для российских экономических интересов, в частности олигархов из В.Ближайшее окружение Путина, которое обслуживается на месте сомнительными дилерами и различными посредниками, некоторые из которых связаны с Сирией, Суданом и Катаром, а некоторые даже участвуют в незаконной торговле ресурсами, проводимой вооруженными группами, состоящими из бывших сторонников «Селеки», процветающих на откатах ».

Информация о тесных контактах «Компании» Пригожина и повстанцев, полученная Центром Досье, представлена ​​в Разделе 2 настоящего отчета. Эта информация подтверждается запиской Кристиана Бадера: «… Русские устанавливают контакты с представителями вооруженных группировок« бывшей Селеки », в частности с ее радикальным крылом в лице Народного фронта возрождения Центральноафриканской Республики (FPRC). во главе с Нуреддином Адамом и Абдулаем Хиссеном, субъектом, контролируемым Службой национальной безопасности Чада и получающим поставки оружия из соседнего Дарфура.Несколько источников (включая Махамата Камуна, бывшего премьер-министра ЦАР, с которым я встречался вчера) сообщают, что ведутся переговоры между НКНР и российскими эмиссарами (включая Евгения Ходотова), встречи проводятся на границе между ЦАР и Суданом. Кроме того, мы подтвердили информацию, предоставленную коллегой из США, согласно которой в конце января суданская разведка организовала переговоры в Хартуме между Нуреддином Адамом и делегацией из России. По словам г.Камун, который утверждает, что он находится в прямом контакте с FPRC, члены этой группы в настоящее время заявляют, что не намерены прекращать диалог при посредничестве комиссии по переговорам Африканского союза, и хотят знать, какую позицию Франция заняла в отношении этих инициатив. , при этом им, видимо, до сих пор сложно сформулировать собственную позицию по этому поводу ».

Сотрудники «Компании», в том числе Валерий Захаров, принимали непосредственное участие в организации встречи в Хартуме 27–28 августа 2018 г., на которой центральноафриканские вооруженные формирования подписали декларацию о соглашении.

Свидетельства того, что поддержку лидеров повстанцев лично координирует Пригожин, можно найти во внутренних чатах между сотрудниками «Компании». Например, 1 мая 2018 года Евгений Копоть написал Дмитрию Сытому: «Для Нур [Нуреддин Адам]: начальник [Евгений Пригожин] просит его выпустить коммюнике, в котором он осуждает нападение на церковь. Чтобы ООН поняла, что Нур за мир в ЦАР » (см.

Добавить комментарий

Ваш адрес email не будет опубликован.